Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029142 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA029142
Gene: DDX47_1
MFE: -14.701
ENS: 0.872
Length: 60.
Predicted Ligands:
fluoride - 18/20
glutamine - 2/20

 RS: URS0000D6C5B2_451757
MFE: -11.552
Ligand: fluoride
Species: Clostridium perfringens NCTC 8239 Fluoride riboswitch
 RS: URS0000C1396E_1284708
MFE: -9.452
Ligand: fluoride
Species: Tissierellia bacterium S7-1-4 Fluoride riboswitch
 RS: URS0000D9BE99_1895812
MFE: -17.258
Ligand: fluoride
Species: Rhizobiales bacterium 63-22 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029142 URS0000D6C5B2_451757 URS0000C1396E_1284708 URS0000D9BE99_1895812
Length 60. 60. 59. 61.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.872 - - -
MFE -14.701 -11.552 -9.452 -17.258
Ligands - fluoride fluoride fluoride
Gene DDX47 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.007 2.008 2.012
Length SE - 0. 1. 1.
Lev Distance - 12. 12. 12.
UBS 4. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 0. 0. 0. 0.
BR 1. 0. 0. 0.
UN 0.267 0.350 0.356 0.377

Sequences

Field Description
UTR seq + 25 ccuacgcgcccauauucacugggccccaccugccuATGGCGGCACCCGAGGAACACGATT
UTR dot + 25 …….(((((…….)))))(((…((((……))))…).))………
RS 1 seq AUUUUUAUAGGCGAUGGAGUUCGCCGUUAAAUGCUUUAUGCUAAUGACUCCUACAAAAUA
RS 1 dot ………(((((……)))))((((…((…..))…))))…………
RS 2 seq AGUUUAAUAGGGAAUGAAGUUUCCCGUUAAUUGCAACUGCUGAUGACUUCUACAAUUUU
RS 2 dot ………(((((……)))))((((…((….))…))))…………
RS 3 seq CAUCGAUGCGGGGAUGGAGUUCCCCUUCACAAGCCGGCCGGCUGAUGACUCCUACCGUUGG
RS 3 dot ………(((((……))))).(((..((((….))))..)))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table