Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029392 Similarity: 0.961 Similarity: 0.960 Similarity: 0.957
UTR: 5HSAA029392
Gene: DEDD2
MFE: -48.823
ENS: 0.837
Length: 147.
Predicted Ligands:
FMN - 13/20
molybdenum - 3/20
TPP - 2/20
 RS: URS0000AB36ED_634177
MFE: -55.506
Ligand: TPP
Species: Gluconacetobacter xylinus NBRC 3288 TPP riboswitch (THI element)
 RS: URS0000D8F619_708126
MFE: -28.715
Ligand: lysine
Species: Trichococcus sp. EX-07 Lysine riboswitch
 RS: URS0000AB1A8D_1078483
MFE: -34.813
Ligand: molybdenum
Species: Haemophilus sp. HK 2154 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029392 URS0000AB36ED_634177 URS0000D8F619_708126 URS0000AB1A8D_1078483
Length 147. 146. 148. 148.
Similarity - 0.961 0.960 0.957
Ensemble Norm 0.837 - - -
MFE -48.823 -55.506 -28.715 -34.813
Ligands - TPP lysine molybdenum
Gene DEDD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 16.004 15.
Length SE - 1. 1. 1.
Lev Distance - 48. 46. 50.
UBS 10. 10. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 1.
ILR 3. 2. 1. 1.
H 5. 6. 5. 5.
BL 1. 1. 0. 1.
BR 2. 1. 1. 1.
UN 0.150 0.144 0.209 0.169

Sequences

Field Description
UTR seq + 25 ggcguaauaauagagaaggugccagaaagauccaaaacaaguggcugcggccgucgcccaggagucaucggacgccagaaucuggccggguucugagcuuguuccgccucccucccccgggaATGGCGCTATCCGGGTCGACCCCGG
UTR dot + 25 ((((……………))))……………..((((((.((((….)))..).)))))).((((((((((((((….)))))))).))..))))((((((((……))))..))))….(((((…..)))))
RS 1 seq GAACGGACCAAGGGGAGUCCCGACAAGGGGCUGAGAGACCGCUGGCAUGGACAACCAUGCGCGCGGAGACCCUUCCGGGCGCAUCGUGCGUUCCGGGGAACCUGAUCCGGCUCAUACCGGCGGAGGGACUGGUGCAGACAAUCGGC
RS 1 dot …….((….))((((((…..))))))……((((..((((((….))))))..))))……(((((((((((…))))).))))))..(((…((((……))))…)))(.(((((…….))))))
RS 2 seq AUAUGAACCAGAGGCCGCGAAAACCAAGAGUAGGAAACGAAAGGGGAAUUCGCCGAAGUAUCGAAUGUGAUACUGGGAUUAUACUGAAUAAGUAUAAUACUGUCAGAAUAAAAUGCCCAAUUUUAUUCAUUGAUGAGCUGUUCAUGUU
RS 2 dot …………….(((((..((……………….))..)))))…(((((((….))))))).((((((((((…..)))))))).))….(((((((((…..)))))))))….((((…..))))…
RS 3 seq UUUUAAUUUAGGCUCCGAGCUUGUUUACCUAAGUUGCGAAAAUAAGGUAACAAUGCCGCAUCAAGCAGAAAAUAUACUAUUUGGUGCCGGGAAGUUUUGGAAACGGAACUUCCUCUCGUGUUUAGAAAGGUGUCCAUGCAAACUAUUC
RS 3 dot …(((((((((……………)))))))))………((((….))))((((((((.((……..)).)))))))).(((((((((((….)))))))))))..((((..((……))..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table