Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029709 Similarity: 0.971 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA029709
Gene: DFFA
MFE: -59.252
ENS: 0.935
Length: 123.
Predicted Ligands:
TPP - 6/20
molybdenum - 4/20
homocysteine - 3/20
 RS: URS0000C24B8B_1768242
MFE: -39.032
Ligand: homocysteine
Species: Paucibacter sp. KCTC 42545 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C6E2B5_499656
MFE: -53.121
Ligand: TPP
Species: Erythrobacter sp. AP23 TPP riboswitch (THI element)
 RS: URS0000C32428_33936
MFE: -39.670
Ligand: guanidine
Species: Aeribacillus pallidus Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029709 URS0000C24B8B_1768242 URS0000C6E2B5_499656 URS0000C32428_33936
Length 123. 122. 123. 123.
Similarity - 0.971 0.970 0.970
Ensemble Norm 0.935 - - -
MFE -59.252 -39.032 -53.121 -39.670
Ligands - homocysteine TPP guanidine
Gene DFFA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.001 17.003 3.011
Length SE - 1. 0. 0.
Lev Distance - 36. 34. 40.
UBS 8. 9. 9. 8.
BS 1. 0. 0. 0.
ILL 2. 3. 5. 1.
ILR 2. 1. 3. 2.
H 3. 3. 3. 3.
BL 3. 3. 1. 2.
BR 2. 3. 1. 2.
UN 0.073 0.098 0.016 0.179

Sequences

Field Description
UTR seq + 25 acaucucccggcaggcugcggaagggggucgaguagaaggaccgccgcuccggccucccgcgacuucucgaaggugggcaggucccaccuuguggaggATGGAGGTGACCGGGGACGCCGGGG
UTR dot + 25 .((((((((((.((((((.((..((.((((………)))).))..)))))))).)))…(((((..((((((((…..))))))))..)))))..))))))).((((…..))))..
RS 1 seq CAUUCCGAGGAGCGUUGCAACCGCAUGCCAAACAUGCGGCCAGGCUCGGGAUCGAAUCUUGCACCGCCGUUUCCACCCGAAACAGCUGCUGUGCCGAUUCAUUGCAACCGCGCUCACCCGCU
RS 1 dot .(((((…((((.(((…(((((((…..))))))).)))))))))))).(((((..((((.((.(((((…..))))).))….)))).)))))………(((……))).
RS 2 seq CAGCCAACCCCGGGGAGCCAGCAGAGUCUUCGUGCUUUGGGCUGAGAGGGGCAGGUUGCGCUGCCCGACCCGUCGAACCUGAACCGAUUAGCAUCGGCGGAGGGAGUGGGCGGCACAUGCCAA
RS 2 dot (((((..((((….((((..((((((……))))))))))….))))..)))))((((.(((…(((((((..((((…..))))..))))))).)))))))((((…..))))..
RS 3 seq AAAAAAGCUGUCUAGGGUUCCGCUGCUGCUUAAGUUUGCAGCAGGUCUGGUCCGAGAGAGAGCGUAUAGAAAGCAUCAAAAGAUGUCUUUCUAUAAACACGGAAGGAUAAAAGCCUGGGAGAU
RS 3 dot ……(((.(((.(((..((((((((((……..)))))))…))))))…))).))).(((((((((((((….)))).)))))))))……..(((…….)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table