Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029710 Similarity: 0.971 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA029710
Gene: DFFA_0
MFE: -59.252
ENS: 0.961
Length: 127.
Predicted Ligands:
cobalamin - 7/20
molybdenum - 6/20
guanidine - 5/20
RS: URS0002313FEB_1206085
MFE: -63.384
Ligand: cobalamin
Species: Jatrophihabitans endophyticus Cobalamin riboswitch
RS: URS0000D7ED8D_1963835
MFE: -49.535
Ligand: guanidine
Species: Arboriscoccus pini Guanidine-I riboswitch
RS: URS0000C088AF_1121324
MFE: -33.528
Ligand: molybdenum
Species: Peptoclostridium litorale DSM 5388 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029710 URS0002313FEB_1206085 URS0000D7ED8D_1963835 URS0000C088AF_1121324
Length 127. 127. 127. 128.
Similarity - 0.971 0.970 0.969
Ensemble Norm 0.961 - - -
MFE -59.252 -63.384 -49.535 -33.528
Ligands - cobalamin guanidine molybdenum
Gene DFFA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 5.001 3.001
Length SE - 0. 0. 1.
Lev Distance - 34. 38. 39.
UBS 8. 6. 8. 8.
BS 1. 3. 0. 0.
ILL 2. 2. 1. 2.
ILR 2. 1. 3. 2.
H 3. 2. 3. 4.
BL 3. 2. 2. 2.
BR 2. 3. 1. 2.
UN 0.102 0.110 0.134 0.125

Sequences

Field Description
UTR seq + 25 aacuacaucucccggcaggcugcggaagggggucgaguagaaggaccgccgcuccggccucccgcgacuucucgaaggugggcaggucccaccuuguggaggATGGAGGTGACCGGGGACGCCGGGG
UTR dot + 25 …..((((((((((.((((((.((..((.((((………)))).))..)))))))).)))…(((((..((((((((…..))))))))..)))))..))))))).((((…..))))..
RS 1 seq UGACGCUGUGAGACGCUGGGGCGGUACCGGAGCCGCAGGAAGCUGGUGCGAGUCCAGCGCGGUCCCGCCACUGUGAGUCCGAUCGUGAUCGGGCGAGUCAGGAACUGCCCCGGUGCGUCACAGCCGC
RS 1 dot ….(((((((..((((((((((((.((((.(((((…..(((((…….)))))))))).)))…((((..(((((((….)))))))..).)))).))))))))))))..)))))))…
RS 2 seq GACAUGGAUGGCUAGGGUUCCUGCUCACGCUUGCAGUGAGUGCACGGUCCAAGAGCCACCCGCCGCGCUGCCUGCAGGCUUGUAGGACCAUCAGCGCGGUACACGGCGGGAUAAAAGCCCGGGAGAU
RS 2 dot …..((.(((((.(((..(((((((((…….)))))))…)))))…))))).))(((((((((((((((….))))))…..)))))))))……((((…….))))……
RS 3 seq UAAUAAGGACUUCUCCGAGUUUGUGAUCCUGAGGCGAAUGAGACUAGAGUCGCUAUGGAAGCAAACCUAUAGGGUUUAUCUGGAAACGGAUGGGCCUCCCGGUGGAAAGGAGAGUUGGGUGAGAACUA
RS 3 dot ……(((….)))..((((((..(((…(((((.(……..).)))))..))).))))))((((.(((((((((((….)))))))))))….))))…….((((…….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table