Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029712 Similarity: 0.958 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA029712
Gene: DFFA_1
MFE: -62.001
ENS: 0.957
Length: 150.
Predicted Ligands:
cobalamin - 8/20
FMN - 7/20
molybdenum - 2/20
 RS: URS0002324CDF_1517936
MFE: -56.493
Ligand: cobalamin
Species: Rhodococcus sp. CUA-806 Cobalamin riboswitch
 RS: URS0002312B1E_1117647
MFE: -54.725
Ligand: cobalamin
Species: Simiduia agarivorans SA1 = DSM 21679 Cobalamin riboswitch
 RS: URS0002318F87_1075402
MFE: -57.145
Ligand: cobalamin
Species: Streptomyces sp. SCSIO 02100 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029712 URS0002324CDF_1517936 URS0002312B1E_1117647 URS0002318F87_1075402
Length 150. 151. 149. 149.
Similarity - 0.958 0.957 0.956
Ensemble Norm 0.957 - - -
MFE -62.001 -56.493 -54.725 -57.145
Ligands - cobalamin cobalamin cobalamin
Gene DFFA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 19. 14.002 10.
Length SE - 1. 1. 1.
Lev Distance - 44. 49. 52.
UBS 13. 12. 12. 13.
BS 0. 0. 0. 0.
ILL 1. 3. 2. 3.
ILR 2. 4. 3. 2.
H 3. 3. 4. 4.
BL 6. 3. 3. 5.
BR 3. 4. 4. 5.
UN 0.040 0.053 0.087 0.060

Sequences

Field Description
UTR seq + 25 cacgugugauuugcugcggaacgaacuacaucucccggcaggcugcggaagggggucgaguagaaggaccgccgcuccggccucccgcgacuucucgaaggugggcaggucccaccuuguggaggATGGAGGTGACCGGGGACGCCGGGG
UTR dot + 25 ..((((.(.(((((((.(((..((……)))))))))))))))))…((.((((………)))).)).(((((((.((((.((((((((((((((((((…..)))))))).))……))))))…)))))).)))))))
RS 1 seq CACACGUGAUGUGCUGGUGCAUACUGCACAGCGAACACAAGCACACCAGUCACAGGGGGAAGCCGGUCGAAAUCCGGCGCUGACCCGCAACGGUGGGUUGCCUCGUCGCGAGGCAGCGAGCCCGAUUACCCAGCGACUGCGUGAGCGGCAC
RS 1 dot ….(.(..((((((((((…..(((………….))))))))).))))..).)..(((((…….)))))((((..(((((.((.((((((((((((…)))))))…………))))).))..)))).)..))))..
RS 2 seq AUCGCACGCAGGUGCCAGGGUGACCACCUAAGGAUGAGUGGUCAUGCUCUGGUUAAAUGGGAAACCGGUGAAACUCCGGUGCUGCCCCCGCAACGGUAAGGCCGAACUGAACGGCCAAGCCCGAUACCGGCCUGAGGCGCGCUUGAAGC
RS 2 dot …((((….)))).((.(((((((((…….).)))))))).))((((((……..))))))……((.(((((.(((((((….(((..(((((…….)))))..)))……)))…).)))))))).))…
RS 3 seq GGUGAUCACGAGGUUCGAGGUGCCCCACGGCGUACGCCACGCCACGGGGAGAAUCUGGGAAGCCGGUGCAAGUCCGGCACAGGGCCCGCUGCGGUAACUCAGGCACAGACCUGGGAAGUCCGAAGACCGGCCUCGAUCCGACCCGGGCG
RS 3 dot …..((.(.((((((……((((..(((((…..)))))..)))).)))))).))).(((((…….)))))…(((((.(((.(((…((((((……))))))….))).)).).)))))((.((((…))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table