Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029754 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA029754
Gene: DGAT2L6
MFE: -26.048
ENS: 0.838
Length: 122.
Predicted Ligands:
SAM - 13/20
TPP - 4/20
FMN - 3/20
 RS: URS0000D8765A_1797873
MFE: -37.649
Ligand: SAM
Species: Deltaproteobacteria bacterium RIFCSPLOWO2_02_44_9 SAM riboswitch (S box leader)
 RS: URS0000DB526C_1563681
MFE: -34.159
Ligand: SAM
Species: Fabibacter misakiensis SAM riboswitch (S box leader)
 RS: URS0000AB572C_693977
MFE: -37.879
Ligand: SAM
Species: Deinococcus proteolyticus MRP SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029754 URS0000D8765A_1797873 URS0000DB526C_1563681 URS0000AB572C_693977
Length 122. 122. 123. 123.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.838 - - -
MFE -26.048 -37.649 -34.159 -37.879
Ligands - SAM SAM SAM
Gene DGAT2L6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 5.001 8.002
Length SE - 0. 1. 1.
Lev Distance - 33. 32. 31.
UBS 6. 6. 7. 8.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 2.
ILR 1. 2. 2. 2.
H 3. 3. 3. 3.
BL 2. 2. 1. 1.
BR 1. 0. 0. 2.
UN 0.287 0.254 0.260 0.244

Sequences

Field Description
UTR seq + 25 aguaagagauuauagcaaagcaucuauaaucaacucagcuuaagaaguuuugaccuucugguuaggcuucuugccacaacagaacagcaccauaaccATGGCTTTCTTCTCCCGACTGAATC
UTR dot + 25 …….((((((((……..))))))))………(((((((.(((((((….))))))))))))))…….((((.((..((((….))))..)).))))…………
RS 1 seq UUCUUAUCAAGAGUGGCGGAGGGAUUGGCCCUUUGAAGCCACAGCAACCGCUCUGAUGUUAUGUCGGGGGUCAGGUGCUAAUUCCGACAAGGCUUAUAUGUGCAAGCCUUGAAAGAUAAGAU
RS 1 dot …………(((((((((((…..))))))…)))))(((.(((.(((((((…..)))))))….))))))……..((((((((……..))))))))………..
RS 2 seq GAUUUAUACAGAAGCGUGGAGAGACAGGCUCUUUGAAGCGCUAGCAACCACCUCUAAUAUUAGAGAAAGGUGCUAAAUCCUGAUCCCAAAGGAUGUCGAGUGACAUUCGGGAGAAUAUAAAUU
RS 2 dot ………….((((((((((…..))))))…))))((((.(((..(((((….)))))…)))))))……..((((…(((((((….)))))))))))………..
RS 3 seq CCUUUAUCCAGAGCGGUGCAGGGAACUGGCCCGAUAACCACCGCAGCAACCGGCCCUCAUUACGGCCACGGUGCUCCGCCAGCCCGCGUGAAUCACGAUGUGAAGCGACGGGAACGAUAAGGG
RS 3 dot …………((((((..(((……)))……))))))(((.(((((((……..))))..))))))…….(((((((…((((…)))).))).))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table