Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029792 Similarity: 0.958 Similarity: 0.957 Similarity: 0.956
UTR: 5HSAA029792
Gene: DGKA
MFE: -37.609
ENS: 0.909
Length: 150.
Predicted Ligands:
FMN - 9/20
glucosamine - 6/20
cobalamin - 3/20
 RS: URS0000C11709_1184607
MFE: -63.501
Ligand: cobalamin
Species: Austwickia chelonae NBRC 105200 AdoCbl riboswitch
 RS: URS0000AB5564_626369
MFE: -30.937
Ligand: glucosamine
Species: Granulicatella elegans ATCC 700633 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB47AA_442346
MFE: -35.570
Ligand: FMN
Species: Francisella novicida GA99-3548 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029792 URS0000C11709_1184607 URS0000AB5564_626369 URS0000AB47AA_442346
Length 150. 149. 150. 150.
Similarity - 0.958 0.957 0.956
Ensemble Norm 0.909 - - -
MFE -37.609 -63.501 -30.937 -35.570
Ligands - cobalamin glucosamine FMN
Gene DGKA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 16. 4.010 3.022
Length SE - 1. 0. 0.
Lev Distance - 49. 57. 58.
UBS 8. 11. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 4. 2. 2.
ILR 3. 2. 3. 3.
H 3. 3. 4. 4.
BL 0. 2. 1. 1.
BR 1. 2. 0. 1.
UN 0.060 0.040 0.160 0.207

Sequences

Field Description
UTR seq + 25 gacuggggaaaauaggucuaaaaggaaagaggaacgugaagaaggccuacccucugaagagguccaagcaacggaaguacuacuacgaagcugccuuucuggccauccuugagaaaaauagacagATGGCCAAGGAGAGGGGCCTAATAA
UTR dot + 25 ((((((((….(((((((…………………..)))))))))))…….))))..(((..((..(((…))).))..)))(((((((((((((((……………..))))))))….)))))))…….
RS 1 seq GCACUGCCGCGGUUGUCGAUCGUUCAGCGAAGCCGGUGAGAAUCCGGCGCUGUCCCGCAACGGUGAUGCCUGUCACUUCCCGGCAGGCUCAGUCCGGUCGCCUGACGGUCGGCUCACAUCGACCCUCGAGGCAAGGGGCCGGGUGACAG
RS 1 dot .(((((..((((…..((…..((((…(((((…….)))))))))))))))..)))))..(((((((…….)))))))(((.(((((((((((((.((((((……)))))).)).))))….))))))))))…
RS 2 seq CAACAUAGGAUAGCGCCAGGCUUAUCAUUAAGAAUGAUAAGUGACGAGGAUUGAGUUUAUCGAAUGAUUCGGCGGGUGACUCAAGGCAGUGCAGUCUACAGCAAUAUACAAAAAUCUCUGUGGGGAUACAAAAUUUUUGCAUGCACCAGA
RS 2 dot …….((……))..((((((((((…))))))))))……..(((((((..(((……….)))..))))))).(((.((((((((((((..((……..))..)))))))…………))))))))……
RS 3 seq AAUAAUCUUCAGGGCAGGGCGAAAUUCCCUACCGGCGGUAACUGCUUAUAGCAGAAGCCCGCGAGCGCUUUCUAAUAAAAAUAGAAAGGUCAAGCAGAUUUGGUGUAAUUCCAAAGCCGACAGUUAAAGUCUGGAUGAAAGAAGAUUGAG
RS 3 dot …………((.((((…….)))).)).((((…(((((…)))))….))))…..(((((((…….))))))).(((..((((((((((………..)))))……..)))))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table