Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029831 Similarity: 0.974 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA029831
Gene: DGKD
MFE: -24.520
ENS: 0.956
Length: 104.
Predicted Ligands:
SAM - 11/20
purine - 4/20
TPP - 3/20
 RS: URS0000C09615_1643451
MFE: -24.478
Ligand: SAM
Species: Sphingobacterium sp. Ag1 SAM riboswitch (S box leader)
 RS: URS0000D8C337_3562
MFE: -24.478
Ligand: SAM
Species: Spinacia oleracea (spinach) SAM riboswitch (S box leader)
 RS: URS0000DA2908_1933868
MFE: -24.478
Ligand: SAM
Species: Sphingobacterium sp. CZ-UAM SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029831 URS0000C09615_1643451 URS0000D8C337_3562 URS0000DA2908_1933868
Length 104. 104. 104. 104.
Similarity - 0.974 0.974 0.974
Ensemble Norm 0.956 - - -
MFE -24.520 -24.478 -24.478 -24.478
Ligands - SAM SAM SAM
Gene DGKD - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 5. 5.
Length SE - 0. 0. 0.
Lev Distance - 34. 34. 34.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 0. 0. 0.
H 4. 4. 4. 4.
BL 0. 1. 1. 1.
BR 1. 2. 2. 2.
UN 0.173 0.192 0.192 0.192

Sequences

Field Description
UTR seq + 25 agagacacgaauauguuucagccgcaacaggcugcguuucagccggaagagugaaagggcaccuugaaaacgcaaguuuATGAATATGTTTCTGTACTTTCAGA
UTR dot + 25 .((((((……)))))).(((……)))((((((((((((………….)))….))))).))))…………….((((……))))
RS 1 seq CGCUUAUAGAGAAAGGCAGAGGGAAUAGACCCGAUGAAGCCUUAGCAACCUGUCCCUUGACAAGGUGCUAAAUUCUACCCUACUUGAUAUGGGAAUGAUAAGCC
RS 1 dot .((((……..))))…(((……)))…(((…(((((.(((((((….)))).)))))))).)))..(((……….)))………..
RS 2 seq CGCUUAUAGAGAAAGGCAGAGGGAAUAGACCCGAUGAAGCCUUAGCAACCUGUCCCUUGACAAGGUGCUAAAUUCUACCCUACAUGAUAUGGGAAUGAUAAGCC
RS 2 dot .((((……..))))…(((……)))…(((…(((((.(((((((….)))).)))))))).)))..(((……….)))………..
RS 3 seq CGCUUAUAGAGAAAGGCAGAGGGAAUAGACCCGAUGAAGCCUUAGCAACCUGUCCCUUGACAAGGUGCUAAAUUCUACCCUACUUGACAUGGGAAUGAUAAGCC
RS 3 dot .((((……..))))…(((……)))…(((…(((((.(((((((….)))).)))))))).)))..(((……….)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table