Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029879 Similarity: 0.973 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA029879
Gene: DGUOK
MFE: -37.928
ENS: 0.932
Length: 110.
Predicted Ligands:
TPP - 8/20
methionine - 7/20
SAM - 3/20
 RS: URS0000D8ED1D_284016
MFE: -46.948
Ligand: TPP
Species: Phenylobacterium zucineum TPP riboswitch (THI element)
 RS: URS0000D985EC_1858794
MFE: -45.875
Ligand: methionine
Species: Mycobacterium talmoniae S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000ABAD69_644966
MFE: -47.775
Ligand: TPP
Species: Thermaerobacter marianensis DSM 12885 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029879 URS0000D8ED1D_284016 URS0000D985EC_1858794 URS0000ABAD69_644966
Length 110. 109. 110. 109.
Similarity - 0.973 0.971 0.971
Ensemble Norm 0.932 - - -
MFE -37.928 -46.948 -45.875 -47.775
Ligands - TPP methionine TPP
Gene DGUOK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 3. 3.007
Length SE - 1. 0. 1.
Lev Distance - 33. 38. 37.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 0. 2. 1. 1.
ILR 1. 1. 1. 1.
H 4. 4. 4. 5.
BL 2. 1. 2. 2.
BR 1. 2. 2. 1.
UN 0.127 0.110 0.136 0.046

Sequences

Field Description
UTR seq + 25 aacggugcgcuggagcgagugagcagcgauaccuagggcggaagugcucucggcggaagugaucgcugugugaaucgugggugggATGGCCGCGGGCCGCCTCTTTCTAA
UTR dot + 25 …(((((((((………..))))).)))).((((((….))))))(((((……..)))))………((((.(((.(((((…))))))))…)))).
RS 1 seq GGUCUGUCCUCGGGGGGCCGCGCUGGAGCGGCUGAGAGGCGGGUAAGCCCGCGACCCGUAGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAACGGACCGUUCGUACGGA
RS 1 dot ……..(((….((((((……))))))..)))(((((….)))))((((((..((……))))))))…((((((((.((……)).))))).))).
RS 2 seq CUUCACGAGACGCCGUCGCCAAGCUCCGACUCGACGGCGCGCCAACCCAGCUCGGGGUGGCUCGGAUGACGAAGCGACCGGCACCGGACGGGCGCCGGUACGGGCGCGGC
RS 2 dot ……….((((((((…((……)))))))))).((((.(((…..))).))))(((…..))).(((((((((.((…..)).))))))…..)))…
RS 3 seq GUAGCACCGUGGGGGUGCUGGCGUCACGCCGGCUGAGACGAGCCGCGGGCUCGAACCCCUCGAACCUGACGUGGGUAAUGCCACCGGAGGGAACGGUGCGGUCCCGCCU
RS 3 dot .(((((((…..)))))))(((…)))(((((……)))))((((.((((…..)))).))))..(((((…((.(((((…….)))))))..)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table