Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029894 Similarity: 0.948 Similarity: 0.946 Similarity: 0.943
UTR: 5HSAA029894
Gene: DHCR7
MFE: -54.963
ENS: 0.708
Length: 187.
Predicted Ligands:
cobalamin - 10/20
Mn2+ - 3/20
TPP - 2/20
 RS: URS0000C4D8D7_1658172
MFE: -53.597
Ligand: TPP
Species: Emmonsia sp. CAC-2015a TPP riboswitch (THI element)
 RS: URS000232FACA_1075402
MFE: -66.882
Ligand: cobalamin
Species: Streptomyces sp. SCSIO 02100 Cobalamin riboswitch
 RS: URS0002326F36_561180
MFE: -70.315
Ligand: TPP
Species: Bifidobacterium gallicum DSM 20093 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029894 URS0000C4D8D7_1658172 URS000232FACA_1075402 URS0002326F36_561180
Length 187. 188. 187. 187.
Similarity - 0.948 0.946 0.943
Ensemble Norm 0.708 - - -
MFE -54.963 -53.597 -66.882 -70.315
Ligands - TPP cobalamin TPP
Gene DHCR7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.001 12.001 6.010
Length SE - 1. 0. 0.
Lev Distance - 61. 66. 74.
UBS 13. 14. 15. 12.
BS 0. 0. 0. 0.
ILL 2. 5. 3. 2.
ILR 5. 5. 4. 3.
H 5. 4. 6. 5.
BL 3. 4. 5. 3.
BR 3. 4. 4. 4.
UN 0.048 0.080 0.086 0.150

Sequences

Field Description
UTR seq + 25 gugcgcaggugaguggccaaggugugcgcaggacuuuagccgguugagaaggaucaagcaggcauuuggagcacaggugucuagaaacuuuuaaggggccgguucaagaaggaaaaguucccuucugcugugaaacuauuuggcaagaggcuggagggcccaATGGCTGCAAAATCGCAACCCAACA
UTR dot + 25 ((((((((((…..)))….))))))).(((((((((((((((.(((((..((….(((((((((…..))))))))).))..)))))….))))))))………)))))))(((((.(((((.(((…))).)))….)).)))))(((….)))(((……)))……..
RS 1 seq GUAUGCAUGAACCGGUGUUCGAUCUCUUAUCCCUCUGCGUUAAUAGCCGCAUCCAACUCUUCUGCCCCACCAAGGGCGAAAGAGAGAUAUUGUUAUUCUGCGCGAAGGCUCUGAGAGAUUGUUCUGAAAUUAUACGGUCAUAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCCUUCAUCUCCU
RS 1 dot ….((((……)))).((((((((((..(((.(((((.((((((…(((…(((((.(((((……))))).))))).)))…))))))..))))).)))…))))))))))..(((..((((..((((((…..))).)))..))))..))).(.((((……)))))…….
RS 2 seq CAACGGUGCUACGGUGCCGGUGCCAGUCAAACUCAGCAUGAGCCAGGGAACCCGGUGCGAUUCCGGGACUGACGCGCAGCGGUGAGGGUGACGGGCGGAGCACGAAGCCACUGGGUCCAGAGGCCCGGGAAGGCGCCCCGUCCGGUUGAUUCCGAGUCCGAAGACCUGCUGGCCGCAGACCCCGUCU
RS 2 dot ….((((((……..)))))).((((..((((.(.((.(((((….(((((…….))))).)))..)).))..).))))..)))).(((((.((…..(((.(((((((….)))))))…))))).)))))(((……))).(((….)))((((…..))))………
RS 3 seq GUCAACCGACACGGGGGCUGGCCCUGCGCCUGUUGCGUUAUAGCGACUCAUAUGCUGCAGUACAGCGGUAUAUUCGACGACUUGCGUAACUGGCAUGCGGAACGCCGGCUGAGAAGGGAAUGGUUCCCUGACCGAUUGAACGUGAAUCCGGAUAAUGCCGGCGCACGGACGUCGUUAUCGCCCGUGC
RS 3 dot (((….)))…..(((((((.(((((((.(((((((…((((….(((((((((……)))))))))….)).)).))))))).)))..))))…)))))))….((((((…))))))………………((((……)))).((((((.((…….)).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table