Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029986 Similarity: 0.986 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA029986
Gene: DHDH
MFE: -21.492
ENS: 0.958
Length: 65.
Predicted Ligands:
fluoride - 17/20
cobalamin - 2/20
unknown - 1/20
 RS: URS0000D8EEC1_1428626
MFE: -24.110
Ligand: fluoride
Species: Streptomyces malaysiense Fluoride riboswitch
 RS: URS0000D93F71_1797178
MFE: -20.529
Ligand: fluoride
Species: Acidobacteria bacterium RIFCSPLOWO2_02_FULL_59_13 Fluoride riboswitch
 RS: URS0000BED912_351627
MFE: -17.346
Ligand: fluoride
Species: Caldicellulosiruptor saccharolyticus DSM 8903 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029986 URS0000D8EEC1_1428626 URS0000D93F71_1797178 URS0000BED912_351627
Length 65. 65. 64. 64.
Similarity - 0.986 0.984 0.984
Ensemble Norm 0.958 - - -
MFE -21.492 -24.110 -20.529 -17.346
Ligands - fluoride fluoride fluoride
Gene DHDH - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.024 9. 4.006
Length SE - 0. 1. 1.
Lev Distance - 17. 17. 19.
UBS 5. 6. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 1. 1. 1. 1.
H 2. 2. 2. 2.
BL 2. 1. 1. 1.
BR 2. 3. 0. 1.
UN 0.246 0.092 0.250 0.172

Sequences

Field Description
UTR seq + 25 cuggagggaccgaaggugccgagggcuccgcaucgcaaccATGGCGCTGCGCTGGGGCATCGTGT
UTR dot + 25 …..((.(((…))).))….((((((((.(((…….))).)))…)))))…….
RS 1 seq GAACGCGCCGGUGAUGGGGCUCACCGCAACCGCGGCGACAUGCCGCUGACGGUCCCUGGUCGAAC
RS 1 dot ….((.(((….))).))((((((..(((((((((……))))).))))…)))).))..
RS 2 seq UAAAUCUUCGGCGAUGGAGUUCGCCCAAACCGUCCGGUCACGGACUGAUGACUCCUGGCGGCCC
RS 2 dot ………(((((……)))))….(((((.(((((……..)))))…)))))…
RS 3 seq UGCUGCAACGGCGAGGGAGUCCGCCGAACAAAUGCCAAUGAUGGCUGAUGACUCCUACAAAUAU
RS 3 dot .((((…))))..(((((((.((((..((……..)).))))….)))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table