Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029997 Similarity: 0.973 Similarity: 0.970 Similarity: 0.967
UTR: 5HSAA029997
Gene: DHPS
MFE: -47.561
ENS: 0.781
Length: 122.
Predicted Ligands:
zmp-ztp - 4/20
TPP - 4/20
SAM - 3/20
 RS: URS0000C489D5_375286
MFE: -41.738
Ligand: zmp-ztp
Species: Janthinobacterium sp. Marseille ZMP/ZTP riboswitch
 RS: URS0000D828C5_1121425
MFE: -48.180
Ligand: molybdenum
Species: Desulfotomaculum australicum DSM 11792 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C5CFFA_1549812
MFE: -45.760
Ligand: zmp-ztp
Species: Massilia sp. BSC265 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029997 URS0000C489D5_375286 URS0000D828C5_1121425 URS0000C5CFFA_1549812
Length 122. 123. 122. 122.
Similarity - 0.973 0.970 0.967
Ensemble Norm 0.781 - - -
MFE -47.561 -41.738 -48.180 -45.760
Ligands - zmp-ztp molybdenum zmp-ztp
Gene DHPS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 11.022 19.003
Length SE - 1. 0. 0.
Lev Distance - 32. 35. 36.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 2.
ILR 3. 2. 1. 2.
H 3. 3. 3. 3.
BL 5. 3. 3. 2.
BR 4. 3. 5. 2.
UN 0.016 0.065 0.164 0.074

Sequences

Field Description
UTR seq + 25 cucuugcggagacgcgcgcgucgggguuuaacgcguuucugggccgccguaagcccggccuaggggcagcuuugacucgagagccggcuauaggcgcATGCCTATAATCCCAGCATTTTGGG
UTR dot + 25 (((.((((……..))))..)))..((((.((((((((((((((.(….)..)))))))))))).)).))))(((((((((.((.(((((((….)))))))…)).)).)))))))
RS 1 seq UUCGUCUCACGUGACUGGCGAAUCCGACUGGUUUUCCUGCUGUUUAUAGGUAAAUUACGUCGUAAGGUGGGCUUACCCACCGUGAAGCGUGAGAUUUCAUUGCCGUGCGCCUGGGUAGCCCGA
RS 1 dot ((((((……….))))))..((((((((((.((((…….)))).)))))).))))…..(((((.((((((.((((..((((((….)))).))..))))..))))))))))).
RS 2 seq GAAUAUCUGGCUCUCCGAGCCAAAAUACCUAAGGCGCUUUGGGGCUAUGGUUUUUGGCCGUUAGGGUGCGCUGGGAAACCGGCGUGCCUUCCAUUGCGAAAAGGAGAGCUGAGCCGGGUAAA
RS 2 dot …….((((((…))))))…..((((..((((((((((((((…….))))).)))))))))..))))…(((((.(((.((((.((….)).)))).)).).)))))…..
RS 3 seq UACGUCUCACGUAACUGGCGAAACACCGUGCGCCCGCGAAUUGUCAUUUGUGCGGCGGCGGUCAAGGUGGGCACCCACCGGGGAACGUGAGAUGUCACCCGCCGUUCGCCUGGGCAGCCAUC
RS 3 dot ..((((……….))))….(((((.(((((((((((….))))))).)))))))))…(((((…((((..((.((((((((….))))…..)))).))))))…)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table