Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA029998 Similarity: 0.973 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA029998
Gene: DHPS_0
MFE: -48.860
ENS: 0.720
Length: 123.
Predicted Ligands:
SAM - 12/20
zmp-ztp - 3/20
molybdenum - 1/20
 RS: URS0000C489D5_375286
MFE: -41.738
Ligand: zmp-ztp
Species: Janthinobacterium sp. Marseille ZMP/ZTP riboswitch
 RS: URS0000D828C5_1121425
MFE: -48.180
Ligand: molybdenum
Species: Desulfotomaculum australicum DSM 11792 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C06C72_1349767
MFE: -43.918
Ligand: zmp-ztp
Species: Janthinobacterium agaricidamnosum NBRC 102515 = DSM 9628 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA029998 URS0000C489D5_375286 URS0000D828C5_1121425 URS0000C06C72_1349767
Length 123. 123. 122. 124.
Similarity - 0.973 0.968 0.967
Ensemble Norm 0.720 - - -
MFE -48.860 -41.738 -48.180 -43.918
Ligands - zmp-ztp molybdenum zmp-ztp
Gene DHPS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.004 8.027 6.019
Length SE - 0. 1. 1.
Lev Distance - 34. 38. 40.
UBS 10. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 3. 2. 1. 3.
H 3. 3. 3. 3.
BL 4. 3. 3. 3.
BR 4. 3. 5. 2.
UN 0. 0.065 0.164 0.137

Sequences

Field Description
UTR seq + 25 gcucuugcggagacgcgcgcgucgggguuuaacgcguuucugggccgccguaagcccggccuaggggcagcuuugacucgagagccggcuauaggcgcATGCCTATAATCCCAGCATTTTGGG
UTR dot + 25 (((((((((……..))))..)))))((((.((((((((((((((.(….)..)))))))))))).)).))))(((((((((.((.(((((((….)))))))…)).)).)))))))
RS 1 seq UUCGUCUCACGUGACUGGCGAAUCCGACUGGUUUUCCUGCUGUUUAUAGGUAAAUUACGUCGUAAGGUGGGCUUACCCACCGUGAAGCGUGAGAUUUCAUUGCCGUGCGCCUGGGUAGCCCGA
RS 1 dot ((((((……….))))))..((((((((((.((((…….)))).)))))).))))…..(((((.((((((.((((..((((((….)))).))..))))..))))))))))).
RS 2 seq GAAUAUCUGGCUCUCCGAGCCAAAAUACCUAAGGCGCUUUGGGGCUAUGGUUUUUGGCCGUUAGGGUGCGCUGGGAAACCGGCGUGCCUUCCAUUGCGAAAAGGAGAGCUGAGCCGGGUAAA
RS 2 dot …….((((((…))))))…..((((..((((((((((((((…….))))).)))))))))..))))…(((((.(((.((((.((….)).)))).)).).)))))…..
RS 3 seq UACGUCUCACGUGACUGGCGAAAAGUUGGCAUGAUCGGCACACAGUGCACCGGAUCUGCCGGCGAAAGGUGGGCACCCACCGGGGAACGUGAGAUUUCAUCAGCCGUUCGCCUGGGCAGCCAAC
RS 3 dot ..((((……….))))….(((((((.(((((((((…)))).)..)))))))))))……..(((.((((..((.((((((((…….)))..))))).))))))..)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table