Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030187 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA030187
Gene: DHX36
MFE: -21.863
ENS: 0.849
Length: 177.
Predicted Ligands:
cobalamin - 13/20
lysine - 6/20
Mg2+ - 1/20
 RS: URS000232463E_508765
MFE: -24.256
Ligand: cobalamin
Species: Clostridium botulinum B str. Eklund 17B Cobalamin riboswitch
 RS: URS000232331C_1156417
MFE: -40.016
Ligand: cobalamin
Species: Caloranaerobacter azorensis H53214 Cobalamin riboswitch
 RS: URS000232E7AA_1121328
MFE: -45.566
Ligand: cobalamin
Species: [Clostridium] paradoxum JW-YL-7 = DSM 7308 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030187 URS000232463E_508765 URS000232331C_1156417 URS000232E7AA_1121328
Length 177. 178. 176. 176.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.849 - - -
MFE -21.863 -24.256 -40.016 -45.566
Ligands - cobalamin cobalamin cobalamin
Gene DHX36 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 11. 11.
Length SE - 1. 1. 1.
Lev Distance - 58. 60. 61.
UBS 8. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 2. 0. 1. 3.
ILR 0. 1. 2. 1.
H 3. 4. 5. 5.
BL 2. 4. 2. 2.
BR 3. 4. 2. 2.
UN 0.249 0.236 0.227 0.227

Sequences

Field Description
UTR seq + 25 guauuucccauuaccccauugugguagguguucuuauaaguaaaaaauuaagugugaagauuuucauuaaaacugaaagcauuucuaaaauugaagauauaaaccuuugugguaguuaauuauuagaagagaaaaccaaggcuuauuaauucATGAGTTATGACTACCATCAGAACT
UTR dot + 25 .(((((.((((………)))).)))))……………….((((((……(((((…….)))))))))))…………………(((((((((((………………..((.(((((((……))))))).))))))))).))))…
RS 1 seq GAAAAUUAAACUGUAUAAGGUGUUUUAUUGACUUAAUAGAGAAUUGGGUGAAAAUCCCAAACUAUCCCAGUAACCGUGAAACUGACGAAAUUCUUAAAUAUACCACUGUAAAAUCCGGGAAGGUGAGAAAAGUAGGAUGAAGUAAAGUCGGGAGACCUGCCAUAUAUGGAAUUUAUAU
RS 1 dot ……….((.(((.((((………)))).))).))..(((((…….)))))…….((((………))))………………….((((((.((((((.((((…………………………)))).))…..)))).)))))).
RS 2 seq AAUAUAGGAGAGAAAAUAGGUUUUUUAUAUUAAAAGGGAAAUCGGUGCAAAUCCGAUACAGCCACCGCUACUGUGAGUGGGUACGAAAUCAAUAAUAAGCCACUGGGUUAACUGGGAAGGCAUUGAGAGUAGGAUGAUCCACAAGUCAGGAGACCUGCCUAUUUUCUACGAGAAGU
RS 2 dot (((((((((((………)))))))))))………(((((…….)))))..(.(((((((….))).)))).)…………….(((.((((…..))))…)))…(((((((((….(((……..)))……)))))))))……….
RS 3 seq AUUAAUAGGGUGGUAUAUGGUGCCCUAGAGGGUUAAAAGGGAAAGUGGUGAAAUUCCACUACAGCCCCCGCUACUGUAAUUGGUGAUGAAAUCCAAAAAAGCCAUUGGGAAACCGAGAAGGCUGGAGAGUAAGAUGAUCCAUAAGUCAGGAAACCUGCCAUAUACUUUUGAGCCAU
RS 3 dot …..(((((((……..)))))))………..(((…((((((……))))))…)))(((((…….)))))……………….((((….))))…((((.(((((((..(((……..(.((((…)))))))).))))))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table