Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030516 Similarity: 0.977 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA030516
Gene: DKC1
MFE: -43.734
ENS: 0.875
Length: 116.
Predicted Ligands:
TPP - 8/20
SAM - 8/20
methionine - 3/20
RS: URS0000C58449_1609099
MFE: -47.687
Ligand: TPP
Species: Streptomyces sp. NRRL F-6602 TPP riboswitch (THI element)
RS: URS0000AB7FB8_431943
MFE: -23.243
Ligand: SAM
Species: Clostridium kluyveri DSM 555 SAM riboswitch (S box leader)
RS: URS0000C56C76_1714016
MFE: -34.192
Ligand: TPP
Species: Domibacillus iocasae TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030516 URS0000C58449_1609099 URS0000AB7FB8_431943 URS0000C56C76_1714016
Length 116. 116. 115. 117.
Similarity - 0.977 0.975 0.974
Ensemble Norm 0.875 - - -
MFE -43.734 -47.687 -23.243 -34.192
Ligands - TPP SAM TPP
Gene DKC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 0.004 6.003
Length SE - 0. 1. 1.
Lev Distance - 30. 32. 31.
UBS 9. 9. 9. 8.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 2. 3. 2. 2.
H 3. 3. 3. 3.
BL 4. 3. 4. 2.
BR 2. 2. 2. 2.
UN 0.138 0.112 0. 0.188

Sequences

Field Description
UTR seq + 25 agcagcgcggccugacgggaccaaggcggcgggagucugcggucguucccucggcuguggaccgggcggcacgcacgcggugcaggguaacATGGCGGATGCGGAAGTAATTATTT
UTR dot + 25 …..(((.((((……….)))).))).(.(((((((((((……))))))))))))..((..(.(((((((.(((……..))).)))..)))))..))……..
RS 1 seq AACAGCCGACAGGGGAGCGCCCACAGCGCUGAGAGUGCGGCCGUACGUCCGUGCGCGCCGCAGACCCUCGAACCUCGCCCGGGUCAUGCCGGGUAGGAAGUCGAUGCACUGAUGAA
RS 1 dot ..((((…..(((…..)))…..)))).(..(((((((((((….))))).))))))..)(.((((.(((.((((((……)))))))))…)))).)……….
RS 2 seq UUCUUAUCAAGAGAGGCGGAGGGACUGGCCCUAUGAAACCCAACAACCGGCAUUUAUUUCAAUAUGUAUCGGUGUUAAUUCCUGCAGAGUUAAUUUAUACUCUGAAAGAUGAGAA
RS 2 dot ……(((..((.(((.(……).))))).)))…..(((.((((((((……….))))..)))))))…..((.((((((……..))))))..))…….
RS 3 seq UAUAUCUGCUGGGGGUGUCCGUUAGCCGGACUGAGAGAAGAGCGCGUUUAUAAGGCUCUUUAACCCUUCGAACCUGAUCUGGCCAGUACCAGCGUAGGGAAGUAGGGGCACGGCAUU
RS 3 dot ….((((((((.((…)).))))).)))……(((((((.(……..))))))))..((((…..((((..((((……))))..))))…..))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table