Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030792 Similarity: 0.981 Similarity: 0.981 Similarity: 0.979
UTR: 5HSAA030792
Gene: DNAH9
MFE: -31.087
ENS: 0.818
Length: 93.
Predicted Ligands:
glycine - 5/20
TPP - 5/20
zmp-ztp - 4/20
 RS: URS0000B6A519_1343159
MFE: -44.831
Ligand: glycine
Species: Loktanella soesokkakensis Glycine riboswitch
 RS: URS0001A11E21_2653135
MFE: -32.196
Ligand: SAM
Species: Citricoccus sp. K5 SAM
 RS: URS0000DA9B38_1337093
MFE: -37.581
Ligand: glycine
Species: Loktanella cinnabarina LL-001 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030792 URS0000B6A519_1343159 URS0001A11E21_2653135 URS0000DA9B38_1337093
Length 93. 92. 93. 92.
Similarity - 0.981 0.981 0.979
Ensemble Norm 0.818 - - -
MFE -31.087 -44.831 -32.196 -37.581
Ligands - glycine SAM glycine
Gene DNAH9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.007 13.
Length SE - 1. 0. 1.
Lev Distance - 21. 24. 20.
UBS 11. 9. 10. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 4. 1.
ILR 3. 3. 2. 3.
H 1. 1. 1. 1.
BL 4. 3. 4. 2.
BR 6. 5. 5. 5.
UN 0.118 0.120 0.032 0.120

Sequences

Field Description
UTR seq + 25 agcagaggagugaguccuggccgcguccccgucgcuagggaaaccgaugcagcuggaggccgcgcgcgATGAACGACCTCAGCAAGATCCATC
UTR dot + 25 .((.((((.((..(((…((((((.((((((.((..((….))…)).)).)).)).)))).)))))..))..)))).))……….
RS 1 seq ACGGUCCUGCCGGGAGAGAGCGGGACGGUCCGCCGCCGAAGGAGCAGUCGCGCGCCCCGCGAUCUCUCAGGCAAAAGGACCGGUUGGGCCGC
RS 1 dot .((((((((((((((((..(((((.((..(.((.(((….).)).)).)..)).)))))..)))))).))))…))))))……….
RS 2 seq CCACCAUCCAGAGCGGCUGAGAGAUCUGGCUCGUCGACGCCGCAGCAACCCGCCCGUCAGGGGCCAGGGUGCUACCGCCAGGACCGAUGGAGC
RS 2 dot ((((..(((.(.((((…((…((((((((.(.((((..((……..)).))))).))))))))…)).))))).)))..).)))…
RS 3 seq ACGGUUCUGCCGGGAGAGAGCAGGACGGUCUGCCGCCGAAGGAGCAGUCGCGCGCCCCGCGAUCUCUCAGGCAAAAGGACCGGUCGGGCCGC
RS 3 dot .((((((((((((((((..((.((.(((((((((…….).))))..)).)).)).))..)))))).))))…))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table