Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030798 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA030798
Gene: DNAI2
MFE: -27.570
ENS: 0.883
Length: 126.
Predicted Ligands:
cobalamin - 8/20
FMN - 3/20
SAM - 3/20
 RS: URS0000D6BE7F_12908
MFE: -46.431
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0002328F57_767029
MFE: -39.272
Ligand: cobalamin
Species: Pseudopropionibacterium propionicum F0230a Cobalamin riboswitch
 RS: URS0002331370_1108812
MFE: -47.538
Ligand: cobalamin
Species: Mycobacterium sp. DSM 45394 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030798 URS0000D6BE7F_12908 URS0002328F57_767029 URS0002331370_1108812
Length 126. 125. 127. 126.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.883 - - -
MFE -27.570 -46.431 -39.272 -47.538
Ligands - GMP cobalamin cobalamin
Gene DNAI2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 3.001 2.
Length SE - 1. 1. 0.
Lev Distance - 37. 39. 41.
UBS 12. 13. 12. 12.
BS 0. 0. 0. 0.
ILL 4. 5. 3. 5.
ILR 4. 3. 5. 4.
H 1. 1. 1. 1.
BL 5. 5. 5. 5.
BR 4. 4. 5. 3.
UN 0.040 0.048 0.016 0.032

Sequences

Field Description
UTR seq + 25 gguaaacgccgccguuugaggagcaccggagccgcgaccguggauugaacgcuuccccagagacccagaagcagaaggagcggacccaggcagccggcaccATGGAGATTGTGTACGTGTACGTCA
UTR dot + 25 .(((.(((.(((.((((……..((((.(((((..((.(((…(..((((((…………………))))))..))))))..)).))).))..)))))).)))..))).)))….
RS 1 seq GGGCGAGCGAGACACGAAGAUCCGGGCAGUCCUCACCGACGCAGCCGCGUAAGCGGACGCGCACGGAGACAAUUCGGCCGCCUAGACGGCCCGGGGAGUGAGUGGCGAGACCGGCUCGUUCGAGC
RS 1 dot …((((((((……….((((.(.(((((((((..((..((((..((…((.((.((.((((…..))))))))))))..)))).))..).))))).)))..).))))))))))))…
RS 2 seq CUCGUUCCGGUAGUGUGAGGUCCGAAGCGUGGGUUAGUCACGAGGAACCCGGUGAAAAUCCGGGACGGUCGCGCCACUGUGAGCCAAUCCAGGCAAGUCAGGAACUCGUCCCACGCCCCGUCGCGGA
RS 2 dot .((((..(((..(((((.(((((((.((.((((((.((((((.((..(((((…….)))))………))..))))).).)))))).))…)).)))……))))))).)))..)))).
RS 3 seq GUUAGGGUAUCGGCGCGAAGUGCCAGGGAAGUCGGUGUGACUCCGACGCAGGCCCGCUACGGUGUUCCGCGGCGCGUUUCACGUGCCCCGGUCAGUCCGAAUACCGGCUUCGCGUCGCCAACACAG
RS 3 dot (((.((….(((((((((..(((.((….((((..(((((..(.(((((((.((((.(((….))).)))).))))…))).)..)))))..))))…)))))))))))))))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table