Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030808 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA030808
Gene: DNAJA1
MFE: -25.821
ENS: 0.956
Length: 88.
Predicted Ligands:
zmp-ztp - 7/20
SAM - 6/20
fluoride - 3/20
RS: URS0000C1C31F_1725411
MFE: -41.775
Ligand: zmp-ztp
Species: Streptomyces sp. CdTB01 ZMP/ZTP riboswitch
RS: URS0000C7BB25_1519493
MFE: -37.535
Ligand: zmp-ztp
Species: Streptomyces sp. NRRL B-3648 ZMP/ZTP riboswitch
RS: URS0000C27F49_1423792
MFE: -23.821
Ligand: fluoride
Species: Lactobacillus perolens DSM 12744 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030808 URS0000C1C31F_1725411 URS0000C7BB25_1519493 URS0000C27F49_1423792
Length 88. 88. 89. 89.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.956 - - -
MFE -25.821 -41.775 -37.535 -23.821
Ligands - zmp-ztp zmp-ztp fluoride
Gene DNAJA1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7. 3.
Length SE - 0. 1. 1.
Lev Distance - 25. 23. 25.
UBS 7. 7. 8. 6.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 1. 0. 2. 1.
H 3. 3. 3. 3.
BL 2. 3. 3. 2.
BR 3. 4. 3. 2.
UN 0.125 0.125 0.124 0.124

Sequences

Field Description
UTR seq + 25 auuggcgccgggaaaccgauggagccgcggucgggaggcaguuggccgcgugggcaguagaagATGGTGAAAGAAACAACTTACTACG
UTR dot + 25 ….((.((((….))…)).))(((((((((…….)))))))))……(((((((.((……….)).))).)))).
RS 1 seq GUGACGGGCCGUGACUGGCGCGCUGGGAUGGGACCGACCAUCGGGGAGCGGCCCGAGCGACUGAGUGCCGUGCGCCUGGGCCGUACCG
RS 1 dot ….((.((((….)))).))….(((((……)))))..((.((((((((.(((((……..)).))).)))))))).)).
RS 2 seq CGAACGGGCCGUGACUGGCGCGCUGGGAUGGGACGGACCAUCAGGGAGCGGCCCGAGCGGGAAGAGUGCCGUGCGCCUGGGCCGAACGU
RS 2 dot ….((.((((….)))).))((..(((((……)))))..))..(((((((.(((.(..(….)..).))).)))))))…..
RS 3 seq AAGUAAAUAGGCGAUGACGUUCGCCAGUGGUGCUGUAUUUAACAGCACUUCAAAUAUUACACUCCGUAAUUGAUGACGUCUGCAAUAUU
RS 3 dot ………(((((……))))).(.((((((((…..)))))))).).((((((.((…(((……..)))..)).))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table