Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA030939 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA030939
Gene: DNAJB8
MFE: -17.713
ENS: 0.857
Length: 79.
Predicted Ligands:
cobalamin - 8/20
SAM - 7/20
TPP - 2/20
 RS: URS0000C853B8_1268237
MFE: -22.462
Ligand: glycine
Species: Aeromonas diversa CDC 2478-85 Glycine riboswitch
 RS: URS00023300BC_408172
MFE: -17.527
Ligand: cobalamin
Species: marine metagenome AdoCbl variant RNA
 RS: URS00023294A3_408172
MFE: -20.971
Ligand: cobalamin
Species: marine metagenome AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA030939 URS0000C853B8_1268237 URS00023300BC_408172 URS00023294A3_408172
Length 79. 80. 79. 79.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.857 - - -
MFE -17.713 -22.462 -17.527 -20.971
Ligands - glycine cobalamin cobalamin
Gene DNAJB8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.012 6. 6.001
Length SE - 1. 0. 0.
Lev Distance - 18. 21. 22.
UBS 8. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 3. 3. 2. 2.
ILR 3. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 1. 2. 2.
BR 2. 1. 2. 2.
UN 0.165 0.275 0.165 0.139

Sequences

Field Description
UTR seq + 25 acacgcugcacccugaacagucugggaccagcggucagggaacaaggaaucgagATGGCTAACTACTACGAAGTGCTGG
UTR dot + 25 …(((((..(((.((….)).)))..)))))………((..(..(((((.(((….))))).)))..)..)).
RS 1 seq AUGAAGGUGGCAGGAGAGCGAUGGGUAACCAUCCACCGAAGAAGUAAAUCUUUCAGGUACCGGGUAACCGGUGUGGACUG
RS 1 dot …..(((((..((..(.(….).)..))..)))))…………..((((..((((((….))))))))))…
RS 2 seq AUACUGAAUCUUGACGGGGAAUUAGUGCGAAAUUCACUUGCUGUUCCUGCAACCGUAUAGUCGGAGUGCCGUCCAGUAU
RS 2 dot .((((((.((((….)))).))))))………..(((((..(..(((.(((……)))..))).)..))))).
RS 3 seq GUACUGAAUCUUGACGGGGAAUUAGUGCGAAAUUCACUUGCUGUUCCUGCAACCGUAUAGUCGGAGUGCCGUCCAGUAU
RS 3 dot (((((((.((((….)))).)))))))……….(((((..(..(((.(((……)))..))).)..))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table