Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA031089 Similarity: 0.962 Similarity: 0.957 Similarity: 0.952
UTR: 5HSAA031089
Gene: DNAJC28
MFE: -55.790
ENS: 0.972
Length: 171.
Predicted Ligands:
cobalamin - 11/20
lysine - 3/20
glycine - 2/20
 RS: URS0000C5578C_1804984
MFE: -69.992
Ligand: glycine
Species: Burkholderia sp. OLGA172 Glycine riboswitch
 RS: URS00007CED20_408184
MFE: -67.
Ligand: cobalamin
Species: Mesorhizobium sp. ORS 3359 Cobalamin
 RS: URS0002322A3C_1690815
MFE: -83.876
Ligand: cobalamin
Species: Pseudonocardia sp. HH130630-07 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA031089 URS0000C5578C_1804984 URS00007CED20_408184 URS0002322A3C_1690815
Length 171. 172. 170. 169.
Similarity - 0.962 0.957 0.952
Ensemble Norm 0.972 - - -
MFE -55.790 -69.992 -67. -83.876
Ligands - glycine cobalamin cobalamin
Gene DNAJC28 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 9. 9.
Length SE - 1. 1. 4.
Lev Distance - 46. 51. 53.
UBS 13. 15. 13. 15.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 2. 3. 4. 4.
H 3. 3. 3. 3.
BL 7. 6. 6. 8.
BR 5. 5. 3. 5.
UN 0.082 0.058 0.071 0.089

Sequences

Field Description
UTR seq + 25 ggugguccccggucgggacgaaggcucccgaggugcccugccuggguccuccgggguaaaguucguuuggcggaagauuguccguuuuccugguaaggucaccugucccaaucaggucauugcuaggaagaacucuggguacaauaATGAATACAATGTATGTGATGATGG
UTR dot + 25 (((((((.(((..(.(((((((.(((((.((((.((((…..)))))))).)))))….))))))).))))..))))).)).((((((((((((.(..(((((…….)))))).))))))))))))…..(.(((((………….))))).)……..
RS 1 seq UUUUCGCACUCUGGAGAGCGGCAGUAGCCGUCUGCGUCGUGUAUGCGCCGUAUACAUCGAGCAGAUUCUGGCAAGCUGCCCACCGAAGGGGCGCGCGCUUAACCGUAGCGAUGGUGGCUUCAACAUCGUACGGCAGCGCAAUCUCUCAGGUAUCGAGGACAGAGGGGUCAUG
RS 1 dot ….(((.((((((…(.((((((.(((((((((.((((((((((…))))))).)))))))))…)))..))))))).))..))))))).(((((…((((.((((((.((….)).)))))))))).))))).(((((((..((…….)).)))))))….
RS 2 seq GCCGCUGCCUGGUGCCCGCGACGCGGGAGAAUCGGGAACACGGUUUCAUUCCGUGGCGUGCCCAACGCUGUGAGGGGGAUCGCGCCGGCAAAUGCCACUGUCGAUGACGGGAAGGCGCCGGAGCGGGACGAUCCCGAGCCAGAAGACCGGCCCGGCAGACAUGGUUUUCC
RS 2 dot ..(((.((.(((.((.(((..(((((((((((((……))))))..)))))))))).)))))..)).)))…((((((((.(((((….(((.(((((…)))))…)))))))).))…..))))))……((((((((…………)))))))).
RS 3 seq GGGCUCGCACCCGACGACGGUGCAGGAAGCCGGUGCGAGUCCGGCGCGGUCCCGCCACUGUCAUCGGGGAGUGCGUCCCCACCCACGGUCACGGCCCCACCCGGGGCGGGAAGGCCGGGACGCGCGUCGAUCCGGGAGCCAGGAGACUGGCCGUCGUCGCAGGAGAUCC
RS 3 dot (((..(((((((((.((((((((.(((.(((((…….)))))….))).)).)))))).)))))…))))..)))..((.(((((.(.(((((….))))).)…)))))))….(((.((((….(.(((((….)))))))))).)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table