Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA031117-20 Similarity: 0.976 Similarity: 0.972 Similarity: 0.971
UTR: 5HSAA031117-20
Gene: DNAJC7
MFE: -29.808
ENS: 0.898
Length: 107.
Predicted Ligands:
TPP - 16/20
glycine - 2/20
homocysteine - 1/20
 RS: URS0000AB2782_862514
MFE: -23.832
Ligand: TPP
Species: Pediococcus acidilactici DSM 20284 TPP riboswitch (THI element)
 RS: URS0000DB0FB2_1801959
MFE: -32.685
Ligand: TPP
Species: Planctomycetes bacterium GWF2_50_10 TPP riboswitch (THI element)
 RS: URS0000D86D83_1797557
MFE: -29.870
Ligand: homocysteine
Species: Burkholderiales bacterium RIFCSPHIGHO2_12_FULL_61_11 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA031117-20 URS0000AB2782_862514 URS0000DB0FB2_1801959 URS0000D86D83_1797557
Length 107. 106. 107. 108.
Similarity - 0.976 0.972 0.971
Ensemble Norm 0.898 - - -
MFE -29.808 -23.832 -32.685 -29.870
Ligands - TPP TPP homocysteine
Gene DNAJC7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 3.001
Length SE - 1. 0. 1.
Lev Distance - 30. 36. 36.
UBS 11. 11. 10. 11.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 4. 3. 3. 3.
H 2. 2. 3. 2.
BL 4. 4. 4. 4.
BR 4. 5. 4. 3.
UN 0.037 0.047 0.028 0.074

Sequences

Field Description
UTR seq + 25 cgguaagauggcggcugccgcggagugcgaugugguaauggcggcgaccgagccggagcugcucgacgaccaagaggcgaagATGTGTCCTAAAAATGCTAGCTATT
UTR dot + 25 ((((..(.(.((.(((((((((……..))))))…))).)).).)..)))).((((((((..((.((….))))..))…………..)).))))…
RS 1 seq UAUCUACACUAGGGGUGUUCGUAGAAGAACUGAGAUGCGCUUGUGCAGCGUGAUCCCUUUGAACCUGUAAGUUGAUACUUGCGAAGGAAAGUGUUUAUUGGGCGAA
RS 1 dot .(((.((.(((.((((((((.(((…..))).)).)))))).)..)).)))))(((..(((((((((((((….))))))…….)).)))))..)))….
RS 2 seq UAGAUUGGCCAGGGGAGCCGGGCGAGAGUUCGGCUGAGAUACCGGUUGGUGACCCUCUGAACCUGAUCGGGGUAAUACCCGCGAAGGGAGUGCUUUAACGGAAACAC
RS 2 dot ((((.(.(((((.((((((((((….))))))))……))..))))).)…))))..(((..(((((((…)))).))).))).(((.(((….))).)))
RS 3 seq CUGUUCGAGGAGCGUUGCAGCCCGCCAGAAACUGCUUGUCAGCUGGCGCGUGAGGCUCGGACACCAGAUCGCCUUGCCGAUUCUGCCUCCCAACCGCGCUCACCCACU
RS 3 dot ..(((.((.(((((((((…..))….))).)))).)))))(((((((.(((((((((.((..((…..))))))))….)))))…..))))).))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table