Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA031733 Similarity: 0.990 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA031733
Gene: DNTTIP2
MFE: -15.101
ENS: 0.860
Length: 63.
Predicted Ligands:
fluoride - 18/20
unknown - 1/20
Ni/Co - 1/20
 RS: URS0000E5FD86_1315974
MFE: -16.785
Ligand: unknown
Species: Sphingobium sp. TKS sul1 RNA
 RS: URS0000BE975F_706587
MFE: -16.875
Ligand: fluoride
Species: Desulfomonile tiedjei DSM 6799 Fluoride riboswitch
 RS: URS0000DA7288_1797892
MFE: -16.242
Ligand: fluoride
Species: Deltaproteobacteria bacterium RIFCSPLOWO2_12_FULL_57_22 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA031733 URS0000E5FD86_1315974 URS0000BE975F_706587 URS0000DA7288_1797892
Length 63. 62. 63. 63.
Similarity - 0.990 0.988 0.988
Ensemble Norm 0.860 - - -
MFE -15.101 -16.785 -16.875 -16.242
Ligands - unknown fluoride fluoride
Gene DNTTIP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 2. 7.
Length SE - 1. 0. 0.
Lev Distance - 12. 15. 14.
UBS 4. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 1.
ILR 2. 1. 2. 3.
H 1. 1. 1. 1.
BL 0. 1. 1. 1.
BR 1. 1. 1. 0.
UN 0.175 0.161 0.190 0.190

Sequences

Field Description
UTR seq + 25 aagagggaagucgugguggucgcgagggagccggaaagATGGTGGTTACCAGATCTGCACGGG
UTR dot + 25 ……….(((((..((((….((..((((………))))..)).))))..))))).
RS 1 seq UUAUGAUCCGCGCCUAACGAAAUUCCGGAUGGGCAUUCCGGCCGCCGAUCCGUCGGACAGCG
RS 1 dot ……….(((….(((…..(((((.(((………))).))))))))….)))
RS 2 seq ACAGAUGACGGGGAUGGAGUCCCCCCAAAAUGCUCGUAAUGAGCUGAUGACUCCUACCGCUAC
RS 2 dot ………(.((..((((((….((….((((…..))))))..))))))..)).)…
RS 3 seq CCAAUUCGCGGAGAUGGCGUUCUCCCUUAACCGCCUACCAGGGCUGAUGACGCCUGCUUCAUG
RS 3 dot ………((((..(((((((.((((…………))))..))..)))))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table