Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA031749 Similarity: 0.982 Similarity: 0.982 Similarity: 0.981
UTR: 5HSAA031749
Gene: DOCK11
MFE: -20.084
ENS: 0.899
Length: 88.
Predicted Ligands:
glycine - 12/20
SAM - 3/20
zmp-ztp - 2/20
 RS: URS0000AB6818_405948
MFE: -25.166
Ligand: SAM
Species: Saccharopolyspora erythraea NRRL 2338 SAM riboswitch (S box leader)
 RS: URS0000AB9733_720555
MFE: -19.427
Ligand: SAM
Species: Bacillus atrophaeus 1942 SAM riboswitch (S box leader)
 RS: URS0000D696EA_12908
MFE: -35.085
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA031749 URS0000AB6818_405948 URS0000AB9733_720555 URS0000D696EA_12908
Length 88. 88. 87. 88.
Similarity - 0.982 0.982 0.981
Ensemble Norm 0.899 - - -
MFE -20.084 -25.166 -19.427 -35.085
Ligands - SAM SAM GMP
Gene DOCK11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 6.001 10.
Length SE - 0. 1. 0.
Lev Distance - 22. 21. 21.
UBS 8. 8. 8. 10.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 2.
ILR 4. 3. 4. 4.
H 1. 1. 1. 1.
BL 4. 2. 2. 6.
BR 3. 2. 2. 2.
UN 0.057 0.045 0.023 0.045

Sequences

Field Description
UTR seq + 25 gcagugaguccacccgcccgccgagguccgcccgcccgccgagacccgcccgccgccgcugccATGGCCGAAGTGCGCAAATTCACCA
UTR dot + 25 …((((((…..(((..((((.(((.((.(.((..((……..))..)).).))..))).))))….)))…..))))))..
RS 1 seq AAUCCAUCCCGAGCGGCCGAGAGACCUGGCUCCGCGACGCCGCAGCAACCACCCGACGGGCAGGUGCUAACGCCAGGACCGAUGGAGU
RS 1 dot ..((((((((..(((….((..((((.((.(((((……………..)).))))))))).))..)))..))…))))))..
RS 2 seq UCCUUAUCAAGAGAGGUGGAGGGACUGGCCCGAUGAUACCCGGCAACCGCUGUUUAACAGAAUGGUGCUAAAUCCUGAAGAUAAGGU
RS 2 dot .(((((((……..(..((((..(((((((.((.((..((((….))))..)).))…))).))))..))))..)))))))).
RS 3 seq GACCUUGGGAGGCGUUGAUCCGAUGGCGGCACGCACGCGGCCACCACGCACCGGCGGUGAGCCACUGGUGAGACCGGCCCGCGAGGCC
RS 3 dot ..(((((.(.((((((…(((.((((.((.(((.((..((……))..)))))))..)))).)))…)))..)))).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table