Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA031750 Similarity: 0.976 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA031750
Gene: DOCK11_0
MFE: -33.714
ENS: 0.869
Length: 99.
Predicted Ligands:
TPP - 9/20
purine - 8/20
fluoride - 1/20
 RS: URS0000AB15B0_290402
MFE: -24.052
Ligand: TPP
Species: Clostridium beijerinckii NCIMB 8052 TPP riboswitch (THI element)
 RS: URS0000BFE85A_864702
MFE: -26.963
Ligand: fluoride
Species: Oscillatoriales cyanobacterium JSC-12 Fluoride riboswitch
 RS: URS0000BF8934_1736411
MFE: -12.361
Ligand: purine
Species: Paenibacillus sp. Soil787 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA031750 URS0000AB15B0_290402 URS0000BFE85A_864702 URS0000BF8934_1736411
Length 99. 99. 98. 100.
Similarity - 0.976 0.976 0.976
Ensemble Norm 0.869 - - -
MFE -33.714 -24.052 -26.963 -12.361
Ligands - TPP fluoride purine
Gene DOCK11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 6.004 11.006
Length SE - 0. 1. 1.
Lev Distance - 30. 29. 27.
UBS 9. 9. 7. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 0. 1. 0.
H 3. 3. 3. 3.
BL 2. 4. 1. 2.
BR 4. 4. 3. 3.
UN 0.152 0.192 0.214 0.230

Sequences

Field Description
UTR seq + 25 cgcgggccggggcagugaguccacccgcccgccgagguccgcccgcccgccgagacccgcccgccgccgcugccATGGCCGAAGTGCGCAAATTCACCA
UTR dot + 25 .(((((.((((…………)))))))))…(((((((……)).).))))((((..(.((((……)))).)..).)))………..
RS 1 seq GACGAGCACUAGGGGAGCCGUAAUGGCUGAGAUGAGUUUUUCAGACCCUUUGAACCUGCACUGGGUAAUGCCAGCGAAGGGAAGUUAUAAGAUAAUAUA
RS 1 dot .(((.((.((…)).)))))…((((((((……)))))).))((((…(((.(.((((……)))).).)))))))……………
RS 2 seq CUGGACUAUGGCAAUGGAGCUUGCCACAACCGCCAUUGGAUCUUGACAUGCCCUCAACUGGGUUGCCAACGUCGAUGGAUGAUGGCUCCUACUUUCCC
RS 2 dot ..((((((((((..(((……)))…..))))).)).)))……((((……)))).((((.((((….)))).))))…………
RS 3 seq GGAACUGAAUACUACCCAUUUCGUAUAACCUUAAUAAUUGGAUUAAGGGUCUCUACUUAGAAACCGUAAAUUUCUAGCUACGACAAAUGUGCGCAUGUCA
RS 3 dot .(((.((………)).)))……(((((((……)))))))(((..((.(((((((…….))))))).)).)))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table