Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032151 Similarity: 0.964 Similarity: 0.957 Similarity: 0.955
UTR: 5HSAA032151
Gene: DPY19L2
MFE: -40.
ENS: 0.898
Length: 167.
Predicted Ligands:
glucosamine - 13/20
cobalamin - 3/20
Mg2+ - 2/20
 RS: URS0000BF21A3_1267
MFE: -31.147
Ligand: glucosamine
Species: Sarcina ventriculi glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BFE0DD_1017270
MFE: -44.808
Ligand: glucosamine
Species: Bacillus sp. NIOC03 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS00023199CC_43989
MFE: -39.448
Ligand: cobalamin
Species: Cyanothece sp. ATCC 51142 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032151 URS0000BF21A3_1267 URS0000BFE0DD_1017270 URS00023199CC_43989
Length 167. 167. 167. 165.
Similarity - 0.964 0.957 0.955
Ensemble Norm 0.898 - - -
MFE -40. -31.147 -44.808 -39.448
Ligands - glucosamine glucosamine cobalamin
Gene DPY19L2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1.002 1.002 11.002
Length SE - 0. 0. 4.
Lev Distance - 48. 58. 50.
UBS 10. 10. 10. 12.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 2.
ILR 2. 2. 2. 2.
H 3. 3. 3. 4.
BL 3. 3. 3. 4.
BR 2. 2. 2. 4.
UN 0.192 0.150 0.150 0.152

Sequences

Field Description
UTR seq + 25 agagacguuccuaaugccgggcgcaccgccggcgggccggcgguuccguuggcuucccugacacacuuccuacagucauuucuuucagcugagaucuuucccuuuaauaccucguuaauuaacguguaaucuuuugguuaaaATGAGAAAACAAGGAGTAAGCTCAA
UTR dot + 25 ……………(((.((((.((((((((….))))))))..)))))))…..((((…………))))………..((((..(((.(((((……((((((..(((((………….)))))))))))…..)))).).))))))).
RS 1 seq AAAUUAUAAAAAGCGCCAGAGCUUAAGUAGAUUAAAAUUUUAUUUAAGUUGACGAGGAUAGGGAAUAUCGAAAUUUCGGCGGAUACCCUACGGUACUUUACACUAUCGAAAAAAAUUGGACAAAACUUAAAAGUAAUUUUAAGGACAAAACCAAUUGAGUGUAAAAU
RS 1 dot ………….((.((..(((((((((((…….))))))))))))).))….(((((.((.((((….))))…)).)))))……(((((((..((((……((((……(((((((….)))))))…….)))))))))))))))..
RS 2 seq GUUAAAUAAAAAGCGCCUGAACUAUUUUCGGACGAAAAGAAAAUAGUUGACGAGGAAGAGGUUCAUCGAUCAUUCGGCGGAUGCCUCUCGGAAUCAGUCACUUUCGUUAGCUUUUAUCUAAAACAGGCAAGGCGACUUCCUGUACAAAAAUAAAAGCAGUGGCUAAU
RS 2 dot ……………..(.((((((((((………)))))))))).)((((..((..((((.((((….)))).))))..))))))…..(((((((…….((((((((…..(((((.(((….))))))))……)))))))))))))))…
RS 3 seq UACAAUGCAAAAAAUAUCGGUUCUAGUGGACAGCAGCCACUAGAAGUAAUGGGGAAAGUUCGGUGUAAAUCCGUCGCUGUCCCGCAACUGUGAUGAGACGUUUCAACUUCUCUUAGGGGUAAAGUUAACGAAGCUAGAAAAAACUGCCAUCUAAUAUUAGUUGAU
RS 3 dot ………………(.(((((((((.(….)))))))))).)..((((((.(((.(((…….)))..))).)))).))..(((……)))..((((((….((((((((..((((……………))))))).)))))….)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table