Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032207 Similarity: 0.927 Similarity: 0.926 Similarity: 0.924
UTR: 5HSAA032207
Gene: DPYSL2
MFE: -57.524
ENS: 0.837
Length: 223.
Predicted Ligands:
cobalamin - 15/20
TPP - 1/20
SAM - 1/20
 RS: URS000232036F_398580
MFE: -80.347
Ligand: cobalamin
Species: Dinoroseobacter shibae DFL 12 Cobalamin riboswitch
 RS: URS00023129C4_89968
MFE: -70.528
Ligand: cobalamin
Species: Hymenobacter gelipurpurascens Cobalamin riboswitch
 RS: URS000232EC0A_323098
MFE: -76.064
Ligand: cobalamin
Species: Nitrobacter winogradskyi Nb-255 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032207 URS000232036F_398580 URS00023129C4_89968 URS000232EC0A_323098
Length 223. 222. 224. 222.
Similarity - 0.927 0.926 0.924
Ensemble Norm 0.837 - - -
MFE -57.524 -80.347 -70.528 -76.064
Ligands - cobalamin cobalamin cobalamin
Gene DPYSL2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.005 11.002 23.008
Length SE - 1. 1. 1.
Lev Distance - 88. 92. 86.
UBS 18. 19. 20. 21.
BS 0. 0. 0. 0.
ILL 6. 7. 7. 5.
ILR 3. 5. 5. 3.
H 4. 2. 3. 4.
BL 7. 8. 7. 10.
BR 8. 6. 9. 6.
UN 0.036 0.104 0.080 0.126

Sequences

Field Description
UTR seq + 25 ccuuucuguugcuaacggaggcgauggugauggugguggugguugugggagaugcagugauccaggauuagaagucgcaucguuugcaaggcauuaaacaggagcgcgagugcacgaagguagccuuagagcgaucgucuucugaucaaaggagguaaaauuguuaaugaugaccagucguucuaugcagacauauacATGGCCGAGAGAAAGCAATCCGGGA
UTR dot + 25 ((((.((((((((……)))))))).)).))((((.((.((((……..(((((..(((..(((((((((.((.(((((((..(((((……..(..((……)).)…….))))).))))))))).)))))))))…)))……))))))))).)).))))……(((((.(……).)))))(((.((……..)))))..
RS 1 seq CGCAGAACAGUCAGGCAUGGUUCCCCGUGCCCGCGCCAAGCGCCCGGGGGAUCAAAUGGGAAUGUGGAACGGUCCGAUCCAAACCGGAGGACCAAAGCCUCAGCCGCCCCCGCGACUGUAUGCGGAGAGGGAGAUCGACAUGCCACUGGGGCCCGCCCCGGGAAGGCCGAUCCACCCCGAUGACCCGCGAGCCAGGAGACCAGCCAUGCGCGACACCCUUAG
RS 1 dot ………….(((((((….)))))))(((((…((((.((.(((.(((..((((…(((((.(((.((..((….((((.((.(….(((((((((..(.((((……..)))).)..))…………..)))))))..))))))))).))))).))))))))).)))))).)).))……….))…)))))……….
RS 2 seq UAUCUUUGCCUGCGUAAAGGUGGCCGGACUCCGAUUGGGGGGCGAGGCUGAAAAGGGAAUCCGGUUUAAUUCCGGAGCUGUCCCCGCAACUGUACGCUUCUUUUUACCAGGCGGUCAUUCCCCCUGCCACUGUUUUGAUGUAGGCCACUUAGUAGCCGGCAAAGAAAUGGGAAGGCGACCGACCCGAAGCAAGCCAGGAGACCUGCCUUUGCAUUUCCUAUGUU
RS 2 dot ..((((((((.((….((((((((..((..(((..(.(((((.(((…….(((((((((.((…….(((((.((.(……..).)))))))……..)).)))..)))))))))))).)).).)))..)).))))))))….)).))))))))..((((..((…))..))))..(((((.((((…)))).))).))…………
RS 3 seq ACUAAAUAUAGUGGCCAAGGUCUCUCGAGUCGCAACACCGAGAGCUAAGAGGGAAGCCGGUGCGUCUCGGUCCGUGAUCCGGGCAAGGCCGGCGCUGCCCCCGCAACUGUAAGCGGCGAGCCGAAGUCCACUUGAGUGUCACUGGGGCUGCAAGGCUCUGGGAAGACCGGACCGAUGCCUGGACCCGCAAGUCAGUAGACCUGCCGUGGCAAAAAAAGAAUG
RS 3 dot ((((….))))……((.((((((.((……))))))))))….(((…((((.(((..(((((((((..(((.((…((((.(((..(((((.((.(((.((((.(((……..).)).)))))))))….))))))))..)))))).)))..)).)))))))))))))).)))(((.(((….))).)))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table