Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032605 Similarity: 0.984 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA032605
Gene: DUSP11
MFE: -25.329
ENS: 0.894
Length: 67.
Predicted Ligands:
fluoride - 13/20
homocysteine - 5/20
cobalamin - 1/20
 RS: URS0000D91D15_62153
MFE: -15.665
Ligand: fluoride
Species: Vibrio shilonii Fluoride riboswitch
 RS: URS000231F5D2_1150591
MFE: -24.121
Ligand: fluoride
Species: Mycobacterium xenopi RIVM700367 Fluoride riboswitch
 RS: URS0000D82817_1895926
MFE: -11.255
Ligand: fluoride
Species: Bacteroidetes bacterium 47-18 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032605 URS0000D91D15_62153 URS000231F5D2_1150591 URS0000D82817_1895926
Length 67. 65. 67. 68.
Similarity - 0.984 0.984 0.983
Ensemble Norm 0.894 - - -
MFE -25.329 -15.665 -24.121 -11.255
Ligands - fluoride fluoride fluoride
Gene DUSP11 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 22. 7.017
Length SE - 4. 0. 1.
Lev Distance - 16. 14. 19.
UBS 5. 5. 6. 3.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 0.
ILR 1. 0. 1. 0.
H 2. 2. 2. 2.
BL 0. 0. 4. 0.
BR 2. 2. 0. 1.
UN 0.134 0.092 0.134 0.265

Sequences

Field Description
UTR seq + 25 aguaagccagcguggcuacgccaucacgaccggcgguggcacATGCGCAATAGCGAGACGCTGGAGC
UTR dot + 25 ………(((((((((((((………)))).)))).)))))((..(((((…)))))..))
RS 1 seq UGCAGCCAAGGUGAUGGGGUUCCACCUACUUAACCGCCAAAUCGGCUGAUGACUCCUACAGUUUC
RS 1 dot ..(((((..(((..(((((((……….)))).))).))))))))..((((…..))))..
RS 2 seq AUUAAUGCUGGCAGUGGGACUCGCCUCCAACCGCGGCCCGGGUGCCGCCGAUGGUUCCUGCGGACCA
RS 2 dot ……((.((((.((((.(.(((……..))))))))..))))))…((((((….))))))
RS 3 seq GAUAAAAAAGGAAAUGGUGUGCUUCCUUACCCAACCGCUUUCCACAAGCUGAUGACGCCUGAUCAUUA
RS 3 dot ………(((((((((……………)))).)))))……((((……..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table