Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032664 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA032664
Gene: DUSP6
MFE: -7.345
ENS: 0.764
Length: 45.
Predicted Ligands:
preQ_1 - 11/20
SAM - 3/20
glutamine - 3/20
 RS: URS0000C19192_1497679
MFE: -8.556
Ligand: preQ_1
Species: Listeriaceae bacterium FSL A5-0209 PreQ1 riboswitch
 RS: URS0000C2DD64_67855
MFE: -8.833
Ligand: preQ_1
Species: Actinobacillus muris PreQ1 riboswitch
 RS: URS0000DAF0C0_505341
MFE: -5.883
Ligand: preQ_1
Species: Gallibacterium salpingitidis PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032664 URS0000C19192_1497679 URS0000C2DD64_67855 URS0000DAF0C0_505341
Length 45. 45. 44. 45.
Similarity - 0.991 0.990 0.990
Ensemble Norm 0.764 - - -
MFE -7.345 -8.556 -8.833 -5.883
Ligands - preQ_1 preQ_1 preQ_1
Gene DUSP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 7. 2.
Length SE - 0. 1. 0.
Lev Distance - 11. 10. 13.
UBS 4. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 0. 1. 1. 1.
H 1. 1. 1. 1.
BL 1. 1. 1. 1.
BR 3. 2. 1. 2.
UN 0.067 0.089 0.045 0.067

Sequences

Field Description
UTR seq + 25 acuacggcuucucagguuagATGATAGATACGCTCAGACCCGTGC
UTR dot + 25 ..(((((..(((.((((…………)).)).))).))))).
RS 1 seq GUUUCCGUGGUUCGGGACAAUCCCACGUAAAAAAACUAAGGAGUG
RS 1 dot ..((((.(((((((((……)).))……))))).))))..
RS 2 seq UUGUUCGUGGUUCGUGAACCUCCCACGCAAAAAACUAAGGAUAU
RS 2 dot .(((((.(((((((((…….))))…..))))).))))).
RS 3 seq AUUGUCGUGGUUCGCAAACCUCCCACGUUAAAAAACUAGGAACAU
RS 3 dot ..((((.(((((….(((…….)))….))))).)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table