Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032698 Similarity: 0.986 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA032698
Gene: DYDC1
MFE: -19.573
ENS: 0.826
Length: 76.
Predicted Ligands:
SAM - 9/20
fluoride - 5/20
homocysteine - 3/20
 RS: URS0000B9B909_1519096
MFE: -20.511
Ligand: SAM
Species: Aquimixticola soesokkakensis SAM riboswitch (alpha-proteobacteria)
 RS: URS0000AB2E27_395495
MFE: -22.365
Ligand: SAM
Species: Leptothrix cholodnii SP-6 SAM riboswitch (alpha-proteobacteria)
 RS: URS0000BFB7E7_1228987
MFE: -13.716
Ligand: glutamine
Species: cyanobacterium endosymbiont of Epithemia turgida isolate EtSB Lake Yunoko Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032698 URS0000B9B909_1519096 URS0000AB2E27_395495 URS0000BFB7E7_1228987
Length 76. 78. 76. 77.
Similarity - 0.986 0.983 0.983
Ensemble Norm 0.826 - - -
MFE -19.573 -20.511 -22.365 -13.716
Ligands - SAM SAM glutamine
Gene DYDC1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 1. 4.002
Length SE - 4. 0. 1.
Lev Distance - 13. 22. 20.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 2.
H 2. 2. 2. 1.
BL 1. 1. 1. 1.
BR 2. 0. 2. 1.
UN 0.145 0.167 0.145 0.104

Sequences

Field Description
UTR seq + 25 cgggacgccgcuccuggguggcgagcaggcgcguguguaggggaguuagaaATGGAGTCAATATATCTTCAAAAGC
UTR dot + 25 ….(((((((.((((………)))).))).)))).(((((..((………….))..)))))……
RS 1 seq ACCUGUCCGCGUGGCGAUUUGCACCUUGCUUGCGGGCCACGUUAAACAUGCCGCUAAACAGGUCGAGGACGCCCCCAC
RS 1 dot ….(((((((.(((((……..))))))))))))..((((……(((……..)))….))))…….
RS 2 seq UGGCCGGACAGCGCCGAUUUGAUCCGGCUUGCGGGCGCUCUAGAAAUGCCGCUAAAGAGGUACACCCGAUCAAUCC
RS 2 dot .((((((((((…….))).)))))))..((((.(………((((……..))))).))))……..
RS 3 seq AUCGUUCAUCUCGACAUAGCUAACAGAAAGGGUUGUGAAGGGACGGAAGUAAGUAAAGACAACUGAAGGAACGCAAG
RS 3 dot .((.((((((((..(((((((………)))))))..))))………………..)))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table