Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032829 Similarity: 0.979 Similarity: 0.978 Similarity: 0.976
UTR: 5HSAA032829
Gene: DYNC1LI1
MFE: -49.730
ENS: 0.978
Length: 113.
Predicted Ligands:
methionine - 11/20
cobalamin - 4/20
TPP - 2/20
 RS: URS0000AB716A_1033810
MFE: -30.083
Ligand: tetrahydrofolate
Species: Haloplasma contractile SSD-17B THF riboswitch
 RS: URS000231B1F8_1273687
MFE: -42.842
Ligand: cobalamin
Species: Mycobacterium sp. VKM Ac-1817D Cobalamin riboswitch
 RS: URS0000BE9DE3_1588023
MFE: -56.431
Ligand: methionine
Species: Arthrobacter sp. Hiyo8 S-adenosyl methionine (SAM) riboswitch,
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032829 URS0000AB716A_1033810 URS000231B1F8_1273687 URS0000BE9DE3_1588023
Length 113. 115. 114. 114.
Similarity - 0.979 0.978 0.976
Ensemble Norm 0.978 - - -
MFE -49.730 -30.083 -42.842 -56.431
Ligands - tetrahydrofolate cobalamin methionine
Gene DYNC1LI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.006 4.003 19.004
Length SE - 4. 1. 1.
Lev Distance - 21. 27. 24.
UBS 7. 8. 6. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 2. 2. 2. 0.
H 2. 2. 1. 3.
BL 1. 3. 2. 4.
BR 2. 2. 2. 3.
UN 0.124 0.043 0.175 0.061

Sequences

Field Description
UTR seq + 25 auauccggguucccgccgccuccaccgccaccgccucagccgccucgcacauuuagucuugccgggaguggugugauucccgaccaagATGGCGGCCGTGGGGCGAGTCGGCT
UTR dot + 25 …..(((…….)))……..((((((((((((((((((………..((((((.(((((((……)))))))..))))))))))))..))))))).)).))).
RS 1 seq CGCAGAGUAAAUGAAGUGCGUUAAGUGCUGUAGGAUGGGAUGUUGCCUACGGACGAAAAAGGACUGAUUAUUGAUUGAUCAGAUUCCUUUGCGAUACUUUGUUGCGUCCGCUGCA
RS 1 dot ((((…………))))…..(((.((.(((((.((((((((………..(((((((((((((…..)))))))..)))))))))))…..))).))))))).)))
RS 2 seq GCCUGAACUACCAUCCGAGGCGAUAGGGCGACUGCGGAUCGUGGAAGCCGGUGUGAAUCCGGCGCGGUCCCGCCACUGUGAUAGCCAGAUACACACCGCAGUCGCCACCUCGCA
RS 2 dot ……………….((((…(((((((((…………..((((((.(((.((((((((……)))))….))).))).)))))))))))))))…)))).
RS 3 seq GGUCAUGAGUGCCAGCGACAGCCCCGGCUUGCUGGCCGGCAACCCUCCUUUCGCGGCGGGGUGCCCGGGUGAAGACCUGGCCUUCGCUGUGUUGGCGGCGGGCAAGCGCGAUGU
RS 3 dot (((…….))).((….))..(((((((((.((((.((((………(((((((((.(.((((((….)))))))))))))))))))).)))).))))))).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table