Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032830 Similarity: 0.971 Similarity: 0.971 Similarity: 0.969
UTR: 5HSAA032830
Gene: DYNC1LI1_0
MFE: -55.924
ENS: 0.932
Length: 129.
Predicted Ligands:
cobalamin - 14/20
FMN - 4/20
TPP - 1/20
 RS: URS0000D877FE_1903186
MFE: -62.049
Ligand: FMN
Species: Brachybacterium sp. P6-10-X1 FMN riboswitch (RFN element)
 RS: URS0000AB6154_446465
MFE: -63.199
Ligand: FMN
Species: Brachybacterium faecium DSM 4810 FMN riboswitch (RFN element)
 RS: URS0000D95A05_1986780
MFE: -24.966
Ligand: cobalamin
Species: bacterium TMED217 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032830 URS0000D877FE_1903186 URS0000AB6154_446465 URS0000D95A05_1986780
Length 129. 130. 130. 130.
Similarity - 0.971 0.971 0.969
Ensemble Norm 0.932 - - -
MFE -55.924 -62.049 -63.199 -24.966
Ligands - FMN FMN cobalamin
Gene DYNC1LI1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7. 10.004
Length SE - 1. 1. 1.
Lev Distance - 35. 35. 36.
UBS 10. 9. 10. 9.
BS 0. 1. 1. 0.
ILL 1. 2. 2. 3.
ILR 3. 3. 3. 4.
H 2. 2. 2. 2.
BL 4. 4. 5. 2.
BR 2. 4. 4. 2.
UN 0.062 0.062 0.046 0.123

Sequences

Field Description
UTR seq + 25 gugcgcugaacgccccauauccggguucccgccgccuccaccgccaccgccucagccgccucgcacauuuagucuugccgggaguggugugauucccgaccaagATGGCGGCCGTGGGGCGAGTCGGCT
UTR dot + 25 (((.((.((((.((……..))))))..)))))…….((((((((((((((((((………..((((((.(((((((……)))))))..))))))))))))..))))))).)).))).
RS 1 seq UCGCGUGCACUGGGGUCGGUGAAAUUCCGAGCCGGCGGUGACAGUCCGCGACCCGAUGGCCUCUGGCCCUCGGCUGACCAGGUGGAACUCCUGGACCGACGGUCAGAGUCCGGAUGGGAAGCGCACGCGG
RS 1 dot .(((((((((((((.((((…….)))).))..)))))……(((..((((.(((.((((((((.((((….(((((…….))))).)))).)))))))).)))..))))..))))))))).
RS 2 seq UCGCGUGCACUGGGGUCGGUGAAAUUCCGAGCCGGCGGUGACAGUCCGCGACCCGAUGGCCUCUGGCCCUCGGCUGACCAGGUGGAACUCCUGGGCCGACGGUGAGAGUCCGGAUGGGAAGCGCACGCGA
RS 2 dot ((((((((((((((.((((…….)))).))..)))))……(((..((((.(((.((((.(((.(((((…(((((…….)))))))))).))).)))).)))..))))..))))))))))
RS 3 seq AAAAGGGAAGUUUGUUAGAAUCAAACACAGUCCCCGCUACUGUAUUUGUAGAAUACAAGUUUUUAUUAGCCAUCUUUGUUUUUUCAAGGAGAAGGUAAACUUAGUUGUCACUACAUGAGUCAGGAAACCU
RS 3 dot ….((((.(((((…….)))))….))))…..(((..(((((((…((((((((……(((.((((((……))))))…))))))))).))…..))))).))..)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table