Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA032962 Similarity: 0.991 Similarity: 0.990 Similarity: 0.990
UTR: 5HSAA032962
Gene: E2F5
MFE: -20.679
ENS: 1.
Length: 62.
Predicted Ligands:
fluoride - 13/20
glutamine - 5/20
purine - 1/20
 RS: URS0000DB6601_882101
MFE: -12.076
Ligand: fluoride
Species: Sinorhizobium fredii GR64 Fluoride riboswitch
 RS: URS0000BF8973_1148
MFE: -13.126
Ligand: glutamine
Species: Synechocystis sp. PCC 6803 Glutamine riboswitch
 RS: URS0000DA1DBB_1797972
MFE: -21.419
Ligand: fluoride
Species: Elusimicrobia bacterium RIFOXYD12_FULL_66_9 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA032962 URS0000DB6601_882101 URS0000BF8973_1148 URS0000DA1DBB_1797972
Length 62. 62. 62. 62.
Similarity - 0.991 0.990 0.990
Ensemble Norm 1. - - -
MFE -20.679 -12.076 -13.126 -21.419
Ligands - fluoride glutamine fluoride
Gene E2F5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7.004 0.001
Length SE - 0. 0. 0.
Lev Distance - 10. 11. 14.
UBS 5. 6. 3. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 1. 1. 0. 1.
H 2. 2. 2. 2.
BL 1. 3. 0. 1.
BR 2. 1. 1. 2.
UN 0.194 0.194 0.258 0.161

Sequences

Field Description
UTR seq + 25 gugcgcgggggcccgaccaccgcggggccgggacgcgATGGACGATTCCATTAATAATAGAT
UTR dot + 25 ..((((..((.((((…….)))).))..).)))((((((….))))))……….
RS 1 seq UAGGAGAGUGGGAAUGGUGUCUCCCCUUUAACCGCGCUGAUGCUGAUGACGCCUGCUGACGA
RS 1 dot ..((((((.((((……..))))))))..))(((.(.((….)).))))……….
RS 2 seq AUCGUUCAUCUUCUCUUUUUGAAGAAGACGGAAGUAGGGAUAUAUUCCUGAAGGAACGCGCC
RS 2 dot .(((((..(((((…….))))).)))))…((((((….))))))…………
RS 3 seq GGGUCGUACGGCGAUGGAGUUCGCCACAACCGCCCGCGGGGGCUGAUGACUCCUACCGAAAA
RS 3 dot ((((.((..(((((……)))))…)).))))..((((((….).)))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table