Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033225 Similarity: 0.957 Similarity: 0.953 Similarity: 0.953
UTR: 5HSAA033225
Gene: EDA
MFE: -48.168
ENS: 0.829
Length: 172.
Predicted Ligands:
glucosamine - 11/20
cobalamin - 6/20
Mn2+ - 2/20
 RS: URS000231FE77_682795
MFE: -49.071
Ligand: cobalamin
Species: Acidobacterium sp. MP5ACTX8 Cobalamin riboswitch
 RS: URS0000E23FFC_1339248
MFE: -66.968
Ligand: glucosamine
Species: Caldibacillus debilis GB1 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000AB94B2_358681
MFE: -59.646
Ligand: glucosamine
Species: Brevibacillus brevis NBRC 100599 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033225 URS000231FE77_682795 URS0000E23FFC_1339248 URS0000AB94B2_358681
Length 172. 171. 173. 171.
Similarity - 0.957 0.953 0.953
Ensemble Norm 0.829 - - -
MFE -48.168 -49.071 -66.968 -59.646
Ligands - cobalamin glucosamine glucosamine
Gene EDA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 6.001 8.
Length SE - 1. 1. 1.
Lev Distance - 54. 59. 58.
UBS 12. 12. 10. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 2.
ILR 4. 3. 3. 2.
H 6. 6. 5. 5.
BL 2. 3. 2. 3.
BR 2. 3. 2. 2.
UN 0.110 0.164 0.145 0.117

Sequences

Field Description
UTR seq + 25 aacuagauagaccauuaguguauccagaguugacauuaccuguguuaaggcucuucgaucaagaacauaacuaggaaucauucgaggugauucaaggccuguuuuccucaggucuugcuaagccugugaccugucagcuaugcuuagATGGGCTACCCGGAGGTGGAGCGCA
UTR dot + 25 …..((((.((…..)).))))..((((((((((…..))))))..))))(((……)))………((((((((…))))))))((((((((…….))))))))(((..(((((((.(((((((((…)))..)))))).)))….))))..)))…
RS 1 seq GGUAUAACUCGGAUAUCUGGUGUUCGGGAAGACGGUGCAAAUCCGUCACUACCGCGUAACUGUAAGCGCUAAGAGCCUGGCAUAUAAGGUCACUGGGAUCAGAGUCCUGGGAAGGCCGAUCAAGCUCCACGAGGCGCAAGUCAGGAGACCGGCCAGAUACGGGCUUAAUUC
RS 1 dot …….(((((((((…)))))))))..(((((…….)))))……((((……..))))…..((((……..))))..(((((((….))))))).(((.((((((..(((.(.(..(((….)))..).)…)))..))).))).)))…..
RS 2 seq UCAUUUUUUCAAGCGCCAGAACUAGGCCCUGGGACGUGCGGGGGCUUAGUUGACGAGGUGGAGGUUUAUCGAGGUGUUCGGCGGAUGCCUCCCGGCUGUGCACACGCAGUCGAGAGCCAUCUUCCCAAAACAUUAAGGCGACUUAAUGGACAAAGGAAGAUGGAAGGUGUGCG
RS 2 dot ………….((((.((((((((((((.(……).)))))))))))..)..))))((……))(((((((((…)))))))))(((((((((….)))))))).)..(((((((((…..(((((((….)))))))……)))))))))……….
RS 3 seq UACCAUUGGAAAGCGCCAGCACUGAGGCUGCCCGACAUGGAGCCCAGUGGACGAGGUGGAGGUUUAUCGAAGCAUUCGGCGGAUACCUCCCGGCAGCAGUAUCACUGCCGCAGAGCGCAGGGACAAAACAUCAGGGUGAUCUGAUGGACAAAACCUUGUGUGUGAUACGUU
RS 3 dot …..((((……))))(((((.((((.((……)))))))))))……..((((((((.(((((…)))))..)).))))))((((((……..))))))((..((((((((……(((((((….)))))))…….)))))))).))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table