Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033473 Similarity: 0.979 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA033473
Gene: EEF2
MFE: -34.267
ENS: 0.956
Length: 108.
Predicted Ligands:
TPP - 16/20
glycine - 2/20
cobalamin - 1/20
RS: URS0000D8DEFD_1928617
MFE: -29.099
Ligand: TPP
Species: Bacillus sp. MRMR6 TPP riboswitch (THI element)
RS: URS0000C7FC8A_931626
MFE: -17.757
Ligand: glycine
Species: Acetobacterium woodii DSM 1030 Glycine riboswitch
RS: URS0000AB97FA_387093
MFE: -32.504
Ligand: TPP
Species: Sulfurovum sp. NBC37-1 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033473 URS0000D8DEFD_1928617 URS0000C7FC8A_931626 URS0000AB97FA_387093
Length 108. 110. 108. 108.
Similarity - 0.979 0.978 0.978
Ensemble Norm 0.956 - - -
MFE -34.267 -29.099 -17.757 -32.504
Ligands - TPP glycine TPP
Gene EEF2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 7.004 9.
Length SE - 4. 0. 0.
Lev Distance - 23. 27. 27.
UBS 7. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 3. 2.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 3. 3. 3. 1.
BR 0. 1. 2. 2.
UN 0.157 0.191 0.222 0.167

Sequences

Field Description
UTR seq + 25 cucuuccgccgucgucgccgccauccucggcgcgacucgcuucuuucgguucuaccugggagaauccaccgccauccgccaccATGGTGAACTTCACGGTAGACCAGA
UTR dot + 25 …….((.((((.(((((…….)))))))))..))…….((.((((((..((((…….((((((……..))))))..))))..))))))))…
RS 1 seq AAAUUCAUUUUUCGGGGGCUGGUGGAAGCUAGCUGAGAUUGCAACUAUUCCGUUGCUGACCGUGUAACCUGUUGGAUAAUGCCAGCGUAGGGAAUGUGAGUAGGGAAACU
RS 1 dot ………((((((.((((……))))..))))))………((((.(((((.((…((..((((((((……)))))..)))..)))).)))))))))…
RS 2 seq AUGAAAGAUACGGGAGAGUCUGCAUGAGAAUGCAGCGCCGAAGGAAUAAACAGAUAUUUAGCCAUAAUAUCCGUGAUGAUCUCAGGUAAAAUGGACCGUAACUGGACA
RS 2 dot ……….(((….(.((((((….))))))).)))……….(((.(((….((((…..((.(((…..)))))….))))…))).)))….
RS 3 seq AUCAAACUCUCGGGGUGCCUCACAAGUUGAGGCUGAGAAGGCCGCAAAAGCCUACCCGCUGAACUUGACCCGGAUCAUACCGGCGUAAGGAAGAGCUUUUGUAACUUA
RS 3 dot …….(((((….((((((…..)))))))))))…..((((((((((.(((((((….(((……)))…)))))…)).)).))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table