Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033623 Similarity: 0.991 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA033623
Gene: EFTUD2
MFE: -13.854
ENS: 0.975
Length: 56.
Predicted Ligands:
unknown - 19/20
Mg2+ - 1/20

 RS: URS0000E6060A_1189611
MFE: -23.752
Ligand: unknown
Species: Nitratireductor aquibiodomus RA22 sul1 RNA
 RS: URS0000E602BA_472175
MFE: -24.
Ligand: unknown
Species: Nitratireductor basaltis sul1 RNA
 RS: URS0000E6074F_1736442
MFE: -21.599
Ligand: unknown
Species: Phenylobacterium sp. Root1277 sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033623 URS0000E6060A_1189611 URS0000E602BA_472175 URS0000E6074F_1736442
Length 56. 56. 56. 56.
Similarity - 0.991 0.991 0.991
Ensemble Norm 0.975 - - -
MFE -13.854 -23.752 -24. -21.599
Ligands - unknown unknown unknown
Gene EFTUD2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2.011 2.011
Length SE - 0. 0. 0.
Lev Distance - 11. 12. 12.
UBS 3. 3. 2. 2.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 0.
ILR 0. 0. 0. 0.
H 2. 2. 2. 2.
BL 1. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.143 0.161 0.250 0.250

Sequences

Field Description
UTR seq + 25 gggaacucuuagcugagcaggcgagagcaucATGGATACCGACTTATATGATGAGT
UTR dot + 25 …..(((((.(((…..))))))))(((((((…………)))))))…
RS 1 seq UUAGGACCCGGUGAAACUCCGGGUGGCUCUGCCGGCCGCUGAUCCGCCGGCGCAAC
RS 1 dot …..((((((…….)))))).((…((((((………))))))))…
RS 2 seq CCUGGACCCGGUGAAACUCCGGGUGGCUCUGCCGGCCGCUUAUCCGCCGGCAUAAU
RS 2 dot …..((((((…….))))))…..(((((((………)))))))….
RS 3 seq CAAGGACCCGCCGUCGCCGCGGGUGGCUAUCUCGGCCGCCGAUCCGCCGGGAAACU
RS 3 dot …..((((((…….))))))…..(((((((………)))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table