Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033773 Similarity: 0.970 Similarity: 0.969 Similarity: 0.969
UTR: 5HSAA033773
Gene: EHF
MFE: -25.277
ENS: 0.922
Length: 118.
Predicted Ligands:
TPP - 11/20
SAM - 5/20
cobalamin - 1/20
 RS: URS0000ABC72A_290400
MFE: -39.967
Ligand: TPP
Species: Jannaschia sp. CCS1 TPP riboswitch (THI element)
 RS: URS0000C0B65B_1472767
MFE: -29.190
Ligand: TPP
Species: Lentibacillus amyloliquefaciens TPP riboswitch (THI element)
 RS: URS0000AB192A_644966
MFE: -47.962
Ligand: TPP
Species: Thermaerobacter marianensis DSM 12885 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033773 URS0000ABC72A_290400 URS0000C0B65B_1472767 URS0000AB192A_644966
Length 118. 117. 118. 117.
Similarity - 0.970 0.969 0.969
Ensemble Norm 0.922 - - -
MFE -25.277 -39.967 -29.190 -47.962
Ligands - TPP TPP TPP
Gene EHF - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.002 11.018 16.004
Length SE - 1. 0. 1.
Lev Distance - 35. 38. 35.
UBS 6. 6. 8. 6.
BS 0. 1. 0. 3.
ILL 2. 3. 1. 1.
ILR 1. 3. 3. 1.
H 2. 2. 3. 3.
BL 2. 0. 2. 4.
BR 2. 1. 1. 1.
UN 0.102 0.145 0.237 0.162

Sequences

Field Description
UTR seq + 25 uuuaaaugaguggaugcaugaauaaaaaagagaauuauaggaaauaggucaauuaaacgccucucauuuuucuccuuagcagagucaccugauATGATTCTGGAAGGAGGTGGTGTAA
UTR dot + 25 …(((((((.((.((..(((………………………….)))..)))).))))))).(((((((..((((((((…….)))))))).)))))))……..
RS 1 seq AGCGGUACCUCGGGGGGGCUCGCGCAUCUGACGAUACGCUGGCCUGAGAUUGCGAAAGCUGACCCGUUGAACCUGAACCGGUUAAUACCGGCGGAGGGAAGGGUAUCGCGGCCAUCG
RS 1 dot .(((((((((((((..((((..(((((((……………..)))).)))..))))..))))…..(((…(((((….)))))…)))…)))))))))……..
RS 2 seq UAUAACUACUAGGGGUGCCCAAAAAACGCGGGCUGAGAGGAAAGGCGUCUACAAGCUUUCCGACUCUUACGGACCUGAUCUGGCUAACACCAGCGUAGGGAAGUAGUCUGACAGCAAU
RS 2 dot …………….((((………)))).(((.(((((.((……..)))))))..)))…(((((((..(((((((……))).))))..))..)))))……..
RS 3 seq AGAGACCGCGGGGGGAGUCCGGGGCAACCGGGCUGAGAGGGCGACUGGGACGGCGUCGCCGACCCCCAUCACCGGAUCCGGAUCAUGCCGGCGUCGGGAAUGCGGUCGCAUGGCGAG
RS 3 dot .(.((((((.((((((((((((…..)))))))…..((((((.(……)))))))..))))).((.((((..((((……))))..))))))..)))))).)……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table