Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033819 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA033819
Gene: EIF1
MFE: -6.394
ENS: 0.983
Length: 64.
Predicted Ligands:
fluoride - 16/20
unknown - 2/20
SAM - 2/20
 RS: URS0000BE975F_706587
MFE: -16.875
Ligand: fluoride
Species: Desulfomonile tiedjei DSM 6799 Fluoride riboswitch
 RS: URS0000BF4A64_868132
MFE: -11.442
Ligand: fluoride
Species: Methanobacterium sp. AL-21 Fluoride riboswitch
 RS: URS0000D6BA73_399795
MFE: -20.329
Ligand: unknown
Species: Comamonas testosteroni KF-1 nhaA-I RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033819 URS0000BE975F_706587 URS0000BF4A64_868132 URS0000D6BA73_399795
Length 64. 63. 64. 64.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.983 - - -
MFE -6.394 -16.875 -11.442 -20.329
Ligands - fluoride fluoride unknown
Gene EIF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.023 2.016 3.048
Length SE - 1. 0. 0.
Lev Distance - 16. 18. 18.
UBS 4. 5. 4. 4.
BS 0. 0. 0. 0.
ILL 2. 3. 2. 2.
ILR 2. 2. 2. 1.
H 1. 1. 1. 2.
BL 1. 1. 0. 0.
BR 1. 1. 0. 1.
UN 0.344 0.190 0.219 0.125

Sequences

Field Description
UTR seq + 25 agucacugagccgccgccgaggaaaaggaaucguaucguATGTCCGCTATCCAGAACCTCCACT
UTR dot + 25 ………………((((….(((..((.((…..)).))…)))….))))….
RS 1 seq ACAGAUGACGGGGAUGGAGUCCCCCCAAAAUGCUCGUAAUGAGCUGAUGACUCCUACCGCUAC
RS 1 dot ………(.((..((((((….((….((((…..))))))..))))))..)).)…
RS 2 seq AUAUGGAAUGGUGAUGGGGUUCACCUUUAACCGCUUAUUUUAAGCUGAUGACUCCUGCACAAUA
RS 2 dot ……….(((..((((((((………(((((…))))))))..)))))..)))….
RS 3 seq GGGUGCCCGUCACACAAGGUGGCGAUGGCAGGUGAAUGUUCAUGCGCAGGUCGGGCCGCCAGCG
RS 3 dot ..(((…….)))..((((((..((((..(((……….)))..)))).))))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table