Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA033935 Similarity: 0.974 Similarity: 0.974 Similarity: 0.972
UTR: 5HSAA033935
Gene: EIF2B2
MFE: -36.434
ENS: 0.939
Length: 107.
Predicted Ligands:
TPP - 11/20
SAM - 4/20
homocysteine - 2/20
 RS: URS0000ABCCB7_509190
MFE: -37.284
Ligand: TPP
Species: Caulobacter segnis ATCC 21756 TPP riboswitch (THI element)
 RS: URS0000D86D83_1797557
MFE: -29.870
Ligand: homocysteine
Species: Burkholderiales bacterium RIFCSPHIGHO2_12_FULL_61_11 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000AB2782_862514
MFE: -23.832
Ligand: TPP
Species: Pediococcus acidilactici DSM 20284 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA033935 URS0000ABCCB7_509190 URS0000D86D83_1797557 URS0000AB2782_862514
Length 107. 106. 108. 106.
Similarity - 0.974 0.974 0.972
Ensemble Norm 0.939 - - -
MFE -36.434 -37.284 -29.870 -23.832
Ligands - TPP homocysteine TPP
Gene EIF2B2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 5.002 5.
Length SE - 1. 1. 1.
Lev Distance - 32. 32. 34.
UBS 10. 9. 11. 11.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 2. 3. 3.
H 3. 3. 2. 2.
BL 3. 4. 4. 4.
BR 4. 3. 3. 5.
UN 0.028 0.094 0.074 0.047

Sequences

Field Description
UTR seq + 25 cucgcccgccccggaagugcaaacuguguggucuggcagguguggauuccgccggugaaggcugaaggcagcuaccuuaaagATGCCGGGATCCGCAGCGAAGGGCT
UTR dot + 25 …(((.((((((.((((….))).).)))…))).)))((((((((((.((((…(((((….))))))))……..).))))))))))(((…..)))
RS 1 seq GCUUGUUCACCGGGGGGUCGCGCGCGCGGCUGAGAUUGGGCUUUCGCCCUGACCCGUAGAACCUGAUCCGGGUCAUGCCGGCGAAGGGAGGGAACGCGGACGCGGU
RS 1 dot .(((.(((((((.(.(……).).))).))))…)))((((((((.(((((((..((……)))))))))….))))))))…….(((….)))..
RS 2 seq CUGUUCGAGGAGCGUUGCAGCCCGCCAGAAACUGCUUGUCAGCUGGCGCGUGAGGCUCGGACACCAGAUCGCCUUGCCGAUUCUGCCUCCCAACCGCGCUCACCCACU
RS 2 dot ..(((.((.(((((((((…..))….))).)))).)))))(((((((.(((((((((.((..((…..))))))))….)))))…..))))).))……
RS 3 seq UAUCUACACUAGGGGUGUUCGUAGAAGAACUGAGAUGCGCUUGUGCAGCGUGAUCCCUUUGAACCUGUAAGUUGAUACUUGCGAAGGAAAGUGUUUAUUGGGCGAA
RS 3 dot .(((.((.(((.((((((((.(((…..))).)).)))))).)..)).)))))(((..(((((((((((((….))))))…….)).)))))..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table