Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034118 Similarity: 0.979 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA034118
Gene: EIF3C
MFE: -43.424
ENS: 0.776
Length: 112.
Predicted Ligands:
TPP - 16/20
glycine - 2/20
cobalamin - 1/20
 RS: URS0000C36547_207745
MFE: -49.741
Ligand: TPP
Species: Variovorax sp. WDL1 TPP riboswitch (THI element)
 RS: URS0000C0395F_543877
MFE: -39.598
Ligand: TPP
Species: Altererythrobacter sp. MSW-14 TPP riboswitch (THI element)
 RS: URS0000D7CF33_173675
MFE: -39.808
Ligand: TPP
Species: Sphingopyxis witflariensis TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034118 URS0000C36547_207745 URS0000C0395F_543877 URS0000D7CF33_173675
Length 112. 111. 112. 112.
Similarity - 0.979 0.976 0.975
Ensemble Norm 0.776 - - -
MFE -43.424 -49.741 -39.598 -39.808
Ligands - TPP TPP TPP
Gene EIF3C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 6. 5.001
Length SE - 1. 0. 0.
Lev Distance - 24. 30. 32.
UBS 8. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 3. 4. 3.
ILR 2. 3. 2. 1.
H 3. 3. 3. 3.
BL 3. 4. 2. 2.
BR 1. 2. 1. 2.
UN 0.062 0.036 0.071 0.027

Sequences

Field Description
UTR seq + 25 cucucggcguuuccgcugucagggcccugcggugugacucgcgggcucagcugguugguccggccguagcaccuccgcgccgucgccATGTCGCGGTTTTTCACCACCGGTT
UTR dot + 25 ….(((((….)))))…((((((.((((……))))))))))((((((.((((..((((((.(((…..(((….)))..))).))))))….))))))))))
RS 1 seq AAGCAACGCUAGGGGUGCCAGCCUGCGGCCCAUGGGUCGCAGGCCGGCUGAGAGAGUCCCUUUGAACCUGACUGAGGUAAUCCUCGCGCAGGGAAGCUGGUCCGGCGGCCG
RS 1 dot ..(((.(……).)))..((((((((((….))))))))))((((((.(.((.(..((((…((((..(((((….)))))..))))))))..).)))..))))))
RS 2 seq GAGCCAUCCCCGGGGAGCCUGUCGCGCAAUCGCAGGUUGAGAGCGGAAUAGCCCGCGACCCGUCGAACCUGAUCCCGGUAAUACGGGCGGAGGGAGGGAAGCGGUUUUCGCU
RS 2 dot …((……))..((((((.((……))))))))…(((((((….((((..(((.((…(((…((((……))))…))))))))..)))).)))))))
RS 3 seq CCCUCAUCCCCGGGGAGCCUGUCGCGUGACCGCAGGUUGAGAGCGGAAUAAACCGCGACCCGUUGAACCUGAUCCGGAUAAUACCGGCGGAGGGAGGGUCGGCGUUUCGUUC
RS 3 dot .((((……))))((((((.((……))))))))..((((((((…..((((((((.(….(((…((((……))))…)))).)))))).))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table