Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034174 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA034174
Gene: EIF3CL
MFE: -33.480
ENS: 0.867
Length: 88.
Predicted Ligands:
SAM - 6/20
glycine - 5/20
homocysteine - 3/20
RS: URS0000312A16_326423
MFE: -19.820
Ligand: SAM
Species: Bacillus amyloliquefaciens FZB42 SAM riboswitch (S box leader)
RS: URS0000C6F6F7_1796491
MFE: -34.177
Ligand: homocysteine
Species: Candidatus Gallionella acididurans S-adenosyl-L-homocysteine riboswitch
RS: URS0000C759DE_1454001
MFE: -28.706
Ligand: glycine
Species: Candidatus Accumulibacter sp. SK-12 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034174 URS0000312A16_326423 URS0000C6F6F7_1796491 URS0000C759DE_1454001
Length 88. 87. 89. 87.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.867 - - -
MFE -33.480 -19.820 -34.177 -28.706
Ligands - SAM homocysteine glycine
Gene EIF3CL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 7. 2.006
Length SE - 1. 1. 1.
Lev Distance - 25. 24. 26.
UBS 7. 8. 6. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 1. 1. 1.
H 3. 3. 2. 3.
BL 3. 3. 1. 3.
BR 3. 2. 3. 3.
UN 0.159 0.138 0.180 0.080

Sequences

Field Description
UTR seq + 25 cccugcggugugacucgcgggcucagcugguugguccggccguagcaccuccgcgccgucgccATGTCGCGGTTTTTCACCACCGGTT
UTR dot + 25 ..(((((((..((((.((.(((…))).)).))))..)))))))…..(((((.(((….))).)))))……(((…))).
RS 1 seq UCCUUAUCAAGAGAGGUGGAGGGACUGGCCCUAUGAUACCCGGCAACCGCUGUUCAGCAGAAUGGUGCUAAAUCCUGAAGAUAAGGU
RS 1 dot ….(((((..((.(((.(……).))))).)))))…(((.((((((((…))))..)))))))….(((…….))).
RS 2 seq CCCUCCGAGGGGUGCUGCAGCGGGGCUGGACACAGUCCCCCGUCAGGCUCGGAGUCAGUGGUUCAACGAUGCAACCGCACCCAUUCAUU
RS 2 dot ..(((((((…..(((..(.(((((((….))))))).)..))).)))))))…((((((((….)).))))))………..
RS 3 seq UCGGCGCGAAUGGGAGAGCACGGCACUGCCGUCGCCGAAGGCGCAAUCCACCCGGAAACGCUCAGGCAAGAGGACCGUUCGUGCAAU
RS 3 dot ((((((…((((.((.((…)).)).)))))))))).((((…(((….)))..))))…(((.(((…..))).)))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table