Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034128 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA034128
Gene: EIF3C_0
MFE: -32.694
ENS: 0.918
Length: 98.
Predicted Ligands:
glycine - 8/20
purine - 4/20
tetrahydrofolate - 3/20
 RS: URS0000C4DA16_344882
MFE: -44.908
Ligand: homocysteine
Species: Pseudoxanthomonas dokdonensis S-adenosyl-L-homocysteine riboswitch
 RS: URS0000C75FBA_943816
MFE: -38.546
Ligand: glycine
Species: Streptomyces sp. 172205 Glycine riboswitch
 RS: URS0000AB2B38_749414
MFE: -35.781
Ligand: glycine
Species: Streptomyces bingchenggensis BCW-1 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034128 URS0000C4DA16_344882 URS0000C75FBA_943816 URS0000AB2B38_749414
Length 98. 98. 98. 98.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.918 - - -
MFE -32.694 -44.908 -38.546 -35.781
Ligands - homocysteine glycine glycine
Gene EIF3C - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 3. 8.
Length SE - 0. 0. 0.
Lev Distance - 25. 26. 25.
UBS 8. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 3. 4.
H 2. 2. 2. 2.
BL 2. 2. 2. 1.
BR 4. 3. 3. 3.
UN 0.082 0.031 0.102 0.082

Sequences

Field Description
UTR seq + 25 guugguauuuuuugggccucgugcuucguggugggagacccagguccggccguagcaccuccgcgccgucgccATGTCGCGGTTTTTCACCACCGGTT
UTR dot + 25 …(((………)))….(((..((((((((((((((((((.((((((.((…)).)).))))..))).))….))))))))))))).))).
RS 1 seq UUCGUCGAGGGGCGCUGCGACCUUGGCCGCCGGUGCGUUGCAUCGCGGUUUUCGGGCCAGGCUCGACGAAACGUUCCGUGUAACGGCGCCCGGUCAAG
RS 1 dot …((((.((….)).))))((((((((..((((((((((((.(((..((((((((…)))))).))..)))…)))))))).))))))))))))
RS 2 seq CGACCCCGUGCGGGAGAGUCCUCCGGUGCAGUUUCCGGAGGCGCCGAAGGAGCAACUCCUCCCCGGAAUCUCUCAGGCUCACGUACCGUGCGGACGAG
RS 2 dot ….(((….)))…((((.((((((((((((..(((((..(((.(((((…)))))…)))..))))).)))))…)))))).).))))…
RS 3 seq AGACCCCGUGCGGGAGAGCUCUCCGCCGACGUCGUCGGAGGCGCCGAAGGAGCAAAUCCUCCCCGGAAUCUCUCAGGCACACGUACCGCGCGGGUGAG
RS 3 dot ….(((….)))….((((((((((((((.((((((((..(((..((((……)))).)))..)))))..)))..))))..)).))))).)))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table