Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034227 Similarity: 0.949 Similarity: 0.949 Similarity: 0.947
UTR: 5HSAA034227
Gene: EIF3E
MFE: -31.913
ENS: 0.889
Length: 178.
Predicted Ligands:
lysine - 10/20
cobalamin - 4/20
FMN - 2/20
 RS: URS0000C74020_1681196
MFE: -68.497
Ligand: Mn2+
Species: Klebsiella sp. RIT-PI-d yybP-ykoY manganese riboswitch
 RS: URS0000AB296F_701176
MFE: -54.836
Ligand: lysine
Species: Vibrio sp. N418 Lysine riboswitch
 RS: URS00023306C0_1321779
MFE: -30.014
Ligand: cobalamin
Species: Leptotrichia sp. oral taxon 215 str. W9775 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034227 URS0000C74020_1681196 URS0000AB296F_701176 URS00023306C0_1321779
Length 178. 180. 180. 178.
Similarity - 0.949 0.949 0.947
Ensemble Norm 0.889 - - -
MFE -31.913 -68.497 -54.836 -30.014
Ligands - Mn2+ lysine cobalamin
Gene EIF3E - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12. 6. 10.002
Length SE - 4. 4. 0.
Lev Distance - 56. 60. 66.
UBS 12. 14. 14. 12.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 2.
ILR 4. 3. 3. 2.
H 4. 3. 4. 5.
BL 5. 6. 5. 3.
BR 3. 5. 3. 3.
UN 0.118 0.111 0. 0.157

Sequences

Field Description
UTR seq + 25 uucuugaaauauauuuccagguaaauuaguuuuaguauuaaucaguuuauuuggggaacuuaaauauauucauuagaaaguuaucuucuuuugcagauauauaaugaaaaggaauuauuacaagguaaauuggaccuucuuagugauaccaacATGGCGGAGTACGACTTGACTACTC
UTR dot + 25 ((((((.((((((((((((((((((((.(((……..))).))))))))))))…….))))))))))..))))…(((((.(….).)))))………..((.(((((((.(((((…….)))))..))))))).))….(((..((((…))))..)))…
RS 1 seq GCGCCCGUCAUUGGGGAGUAGCCGAUUUCCACCGUUCCCGGAAAUGUACGUGUCAACAUACUCGUUGAAAGACGUGGCGCGUACGGGUCGCAGUACUGCGAUCAGGCGAGACCAUAGGCGCAUCAACCACUGUUUACUGGGGGUGGUGAUGUGUUUAAUGGUUCCCGGUCAGGACGUUAU
RS 1 dot (((((((((.((((.(((((((((((((((………))))))…)).))…..))))).))))..)))).)))))…..(((((((….))))))).((.((.((((((((((((((.((((((.((….)).)))))))))))))))).))))))))…………..
RS 2 seq AAUCACAGAAGAGGAGCACUGCCUAGGUAGAUGCAUCGUGGAGCCACAACUCCGAUACGGUGUGUUGAAGGGAGAGCAGUGCCGAGAUUGCGCUAAAUUGUCGGAUUAGAGCAGUCGGUUGACUUGAGUUGAUUCUCAUCAAUUGUCAUCAGCACCGCCUGAUGAAGCGCUUCUGAGGUG
RS 2 dot ………….(.(((((((((…..((((((((((((((……))))…))))))))))……)).))))))))..((((((.((.((((….)))))).)))))).(((((..(((((((((….))))))..))))))))..(((((.(.(((….)))).)))))
RS 3 seq AAUUUCAUAUUUUUAUAUAGUGAUAUUUUUACAAUAUUGAAAAGGGAAUCCGGUUUGAAUCCGGAACAGCUCACUCUACUGUAUUAUGGACGAAAAUCUCAAUAACCACUCUUUCCGGGGAAGGUGAGAUUUAAGGAAGAAGUUAAGUCAGGAGACCUGCUAUAUAAUUUAAUACAAA
RS 3 dot .(((((…(((((((((.((((…..)))).)))).))))).)))))((((…….)))).((((………))))………..(((((((….(((.((((….))))..))))))))))…….((((((((.((((…))))))…))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table