Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034275 Similarity: 0.959 Similarity: 0.952 Similarity: 0.951
UTR: 5HSAA034275
Gene: EIF3H
MFE: -46.851
ENS: 0.950
Length: 164.
Predicted Ligands:
SAM - 9/20
Mg2+ - 6/20
FMN - 2/20
 RS: URS0000D86339_1777132
MFE: -53.127
Ligand: FMN
Species: Caballeronia peredens FMN riboswitch (RFN element)
 RS: URS0000DB553D_68249
MFE: -69.383
Ligand: SAM
Species: Streptomyces pactum SAM riboswitch (S box leader)
 RS: URS0000C30C18_1300347
MFE: -75.464
Ligand: SAM
Species: Nocardioides dokdonensis FR1436 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034275 URS0000D86339_1777132 URS0000DB553D_68249 URS0000C30C18_1300347
Length 164. 166. 165. 163.
Similarity - 0.959 0.952 0.951
Ensemble Norm 0.950 - - -
MFE -46.851 -53.127 -69.383 -75.464
Ligands - FMN SAM SAM
Gene EIF3H - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 10.004 8.002
Length SE - 4. 1. 1.
Lev Distance - 49. 58. 60.
UBS 13. 12. 11. 13.
BS 0. 1. 0. 0.
ILL 2. 2. 2. 3.
ILR 6. 6. 4. 4.
H 2. 2. 3. 3.
BL 5. 5. 4. 4.
BR 3. 3. 3. 4.
UN 0.055 0.108 0.115 0.104

Sequences

Field Description
UTR seq + 25 gugcguacgcuggaaaaccgcuggggugcgcgauuccgcacgggggcgcacaugcgcagucuggggccacgaucauuccaucggaaagaggucgaaaauguacaguaggcaugcacaaaggauaccgccuggaaagaagATGGCGTCCCGCAAGGAAGGTACCG
UTR dot + 25 .(((((((.((((…….)))).))))))).((((((…(((((((.((((.((((((((.(..(((((((.((((…))))…)))))….))..)..))))).))).))…………………..)))))))))))..))))…….
RS 1 seq ACAUGUUCUCGGGGCGGGGUGAGAUUCCCCACCGGCGGUAAUCAUCCAGCAAUUGCCAAGGGAUGUAGCCCGCGAGCGCUUAUCGAAUGAUCGCUUGUUCGAUAGGGUCAGCAGACUCGGUUAGAUUCCGGGGCCGACGGUAUAGUCCGGAUGAAAGAGAACAGGA
RS 1 dot …(((((((..((.((((…….)))).))……..((((((.((.((((((..(((((.((((((((..((.((((((((((((….))))))))))))))..)).)….))))).)))))..)))….)))…))..))))))..)))))))…
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGAUACGGCCCGUUGAAGCCCCGGCAACCCUCCAGUCGGUUCUUGUCGCACAUCGGUUUCUGUCACACCGGUACGGCGAGGCUCCCGACUAGGGAAGGUGCCAAAUCCGUCUCACGGCGAGAUGCGUCGUGAGGAAGAUGAGGA
RS 2 dot …………(((((((.(((……))).))…)))))(((.(((.(((((((((.((((((((…((((((………)))))).))))))))…))))))..))).))))))..(((..((((((((((…..))))))))))..)))…..
RS 3 seq AGCUCAUCAAGAGGGACUGAGGGAACGGCCCGUCGACGUCCCGGCAACCGCCACGAUCCUCCGCCCACCGGGCGGUCCGCACCUGCGGCCCGCCUGCGACAGCGGUUCGUGGAAACGGUGCUACAUCCGGCCCGGUGCGAAGGACGCCCGGGGAAGAUGAGGA
RS 3 dot …………((((((((.((……)).)))..)))))(((.((((((((((….((((…((((((((.((((….)))).))))))).)…)))).))))))…))))))).((((…(((((.(((…..))))))))…))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table