Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034280 Similarity: 0.980 Similarity: 0.980 Similarity: 0.978
UTR: 5HSAA034280
Gene: EIF3I
MFE: -24.004
ENS: 0.984
Length: 97.
Predicted Ligands:
TPP - 16/20
glycine - 2/20
zmp-ztp - 1/20
 RS: URS0000D92DAC_623280
MFE: -28.717
Ligand: TPP
Species: Parapedobacter sp. 4M29 TPP riboswitch (THI element)
 RS: URS0000D83118_1940
MFE: -38.310
Ligand: glycine
Species: Streptomyces albireticuli Glycine riboswitch
 RS: URS0000AB1D15_525370
MFE: -31.272
Ligand: TPP
Species: Rhodococcus equi ATCC 33707 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034280 URS0000D92DAC_623280 URS0000D83118_1940 URS0000AB1D15_525370
Length 97. 97. 96. 97.
Similarity - 0.980 0.980 0.978
Ensemble Norm 0.984 - - -
MFE -24.004 -28.717 -38.310 -31.272
Ligands - TPP glycine TPP
Gene EIF3I - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.007 3.001 12.005
Length SE - 0. 1. 0.
Lev Distance - 26. 25. 24.
UBS 9. 8. 8. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 0.
ILR 3. 2. 2. 1.
H 3. 3. 3. 3.
BL 2. 2. 2. 2.
BR 3. 3. 3. 3.
UN 0.124 0.206 0.094 0.196

Sequences

Field Description
UTR seq + 25 auaauccggaagugaccucgaaaccuuuuccggucuuacucacguugcggccuuccucgcgucacagccgggATGAAGCCGATCCTACTGCAGGGCC
UTR dot + 25 ……((..(((((((..((((…)))).))))..)))..))…(((((.((((.((……)).)))).)..)))).((((…..))))..
RS 1 seq AAGAUGUGCAGGGAGUGCUUGAGCCAAUCAGGCUGAGAUGAUAUCCCCGAACCUGAACUGGAUAAUGCCAGCGCAGGGAAAGCGCGUCGGUACGACG
RS 1 dot ……….(((.((((((.((((…..)))).))..).))).)))…((((..((((……))))..))))…….(((((…)))))
RS 2 seq CGAAUCCGCGCGGGAGAGUUCCAGCCGUCCCGUGCUGGACGCCGAAGGAGCAAGUUCCUCCCUUGAAUCUCUCAGGCCCCGUACCGCGCGGGUGAG
RS 2 dot ….(((((((((((..((….))..)))))))).))).(((((.(((.((((…….))))..))).)).)))(((((…..)))))….
RS 3 seq UUCACUGACACGGGGUGCUCCGCACGGGCGGGGCUGAGAUCACACCCGGGAACCUGCAUCAGGUAAUGCUGACGAAGGGAUGUCAAGGCGAUGACUA
RS 3 dot ……….(((((((((((((….)))))))…….)).))))….(((.(.((((……)))).).)))…((((……))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table