Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034368 Similarity: 0.955 Similarity: 0.954 Similarity: 0.953
UTR: 5HSAA034368
Gene: EIF4A1
MFE: -57.575
ENS: 0.909
Length: 161.
Predicted Ligands:
cobalamin - 9/20
Mg2+ - 6/20
SAM - 2/20
 RS: URS0000AB2854_469617
MFE: -42.436
Ligand: Mg2+
Species: Fusobacterium ulcerans ATCC 49185 M-box riboswitch (ykoK leader)
 RS: URS0000C3BA14_1318466
MFE: -31.954
Ligand: Mg2+
Species: Acholeplasma palmae J233 M-box riboswitch (ykoK leader)
 RS: URS000231B7D8_1844708
MFE: -70.092
Ligand: cobalamin
Species: Desulfovibrio sp. DV Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034368 URS0000AB2854_469617 URS0000C3BA14_1318466 URS000231B7D8_1844708
Length 161. 162. 161. 162.
Similarity - 0.955 0.954 0.953
Ensemble Norm 0.909 - - -
MFE -57.575 -42.436 -31.954 -70.092
Ligands - Mg2+ Mg2+ cobalamin
Gene EIF4A1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8. 18.001 6.005
Length SE - 1. 0. 1.
Lev Distance - 55. 52. 58.
UBS 13. 12. 11. 13.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 3.
ILR 3. 4. 2. 3.
H 4. 5. 5. 5.
BL 6. 4. 4. 4.
BR 2. 2. 4. 1.
UN 0.118 0.099 0.087 0.049

Sequences

Field Description
UTR seq + 25 ggaacuaacgucaugccgaguugcugagcgccggcaggcggggccggggcggccaaaccaaugcgauggccggggcggagucgggcgcucuauaaguugucgauaggcgggcacuccgcccuaguuucuaaggaucATGTCTGCGAGCCAGGATTCCCGAT
UTR dot + 25 ((..(…((((.(((((.(((….)))..))))))))))..))….((((((………..))))))(((((((((.(..(((.((((………)))))))..))))))))))……….(((((.((.((…)).)).)))))…..
RS 1 seq AAAUAGAUCCGGUAGGUAAGGCUACUACAGGGAUAUGGGUUGCUGCCGCAAAAUAGUGGAGACACUAUGCGUUGGUUUGAACAGGCGAUAUCGAAACCAAGGUAUCAUCUAAUGCAACUUCACCGCCCUGUAGAGUUAAAGCUCAAACGGUGGCGUAAAUCA
RS 1 dot ……((((.((((………))))..))))…(((….)))(((…(((((….))))))))((.((((…..(((.((((((……..)))))).)))…..))))..))((((((((.((((….))))..)))).))))…….
RS 2 seq AAUCAUUGCUGGUAGGUGAGGCUACUUUAAGGAUACGGAUUACUGCCGUCACUUUGUGGAGACAAAAAGUGUUUGGUUUGAAAAGUCUAAAUCGGAUCAAGGUUUAGAAUAAUGUAAUUUCAUUGCCUUAUUGAGCUAAAACUUAAACAUUGGCUUUUUAA
RS 2 dot .(((.(((..(((((……))))).))).)))((((…….))))((((((.((….)).))))))…(((.((((((.((((((((…….)))))))).)…….)))))..)))…..(((((((……….)))))))…..
RS 3 seq GCCCUUCGGGGCUUAAACGGGAAUCCCGUGUAAAUCGGGAGCGGUCCCGCCGCCGUCAGUCCCCCACACAGUCGGCCUCCUCGCGCGCCACUGGGAUACUCUCCCGGGAAGGCCGGGGCCGAUGGGACAAGCCGGAAGACCUGCCCGGGUCCUGGCGCGUCC
RS 3 dot (((……)))(((.(((((…))))).)))…(((((((((……)))))…))))…..((.(((((((…..((.(((.((((((…..))))))…))))))))))))))((((..(((((..(((((….))))))))))..))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table