Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034446 Similarity: 0.954 Similarity: 0.953 Similarity: 0.952
UTR: 5HSAA034446
Gene: EIF4E2
MFE: -60.257
ENS: 0.912
Length: 163.
Predicted Ligands:
TPP - 7/20
cobalamin - 4/20
glycine - 3/20
 RS: URS0000ABA2BB_2604047
MFE: -70.666
Ligand: glycine
Species: Paraburkholderia sp. Msb3 Glycine
 RS: URS0000AB8F2F_196627
MFE: -41.304
Ligand: cobalamin
Species: Corynebacterium glutamicum ATCC 13032 AdoCbl riboswitch
 RS: URS0000DB4A81_4232
MFE: -61.553
Ligand: TPP
Species: Helianthus annuus (common sunflower) TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034446 URS0000ABA2BB_2604047 URS0000AB8F2F_196627 URS0000DB4A81_4232
Length 163. 164. 162. 164.
Similarity - 0.954 0.953 0.952
Ensemble Norm 0.912 - - -
MFE -60.257 -70.666 -41.304 -61.553
Ligands - glycine cobalamin TPP
Gene EIF4E2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 6. 8.002
Length SE - 1. 1. 1.
Lev Distance - 57. 58. 58.
UBS 14. 13. 14. 12.
BS 0. 0. 0. 0.
ILL 1. 3. 3. 2.
ILR 4. 3. 4. 3.
H 3. 3. 3. 3.
BL 5. 5. 6. 4.
BR 3. 3. 4. 4.
UN 0.043 0.073 0.049 0.085

Sequences

Field Description
UTR seq + 25 agccgcuuccaaaccgggccugcgcgccgacguuccgcugcgccccgcgcaaaaccggaaguacccgggcccaaggcugagggacccgguggagcggaagucacucccugaggcaguggcgacagcggcggcgagaggATGAACAACAAGTTCGACGCTTTGA
UTR dot + 25 ..(((((((…(((((((((((((.(((((.(((((.(((((…)))))….)))))))…)))))…..))…))).)))))))))))))..((((((((….)).))))))..(((.((((.((((……………)))).))))))).
RS 1 seq UUUUCGCACUCUGGAGAGCGGCAGUAGCCGUCUGCAUCGCGCGUUUCGUAUGCGUGCGAGCAGAUUUGGCAGGCUGCCCACCGAAGGGGCGCGCGUUUCACCGUGGCGGAUUCACGUUCGCACGGCAACGCAAUCUCUCAGGUAUCGAGGACAGAGGGGCCAUG
RS 1 dot ….(((.((((((…(.((((((.(((((((((.((((((((…….))))))))))))))..)))..))))))).))..))))))).(((((…((((.((((((….)))))))))).)))))..((((((..((…….)).))))))…..
RS 2 seq AGGACACCAUCCGUUCUUUUUCAGGGGAAUUUCGGUGAGAACCCGAAGCUGACCCGCAACCGUAUUAUGCAAUCGCUUUCACCAGGUAUUGCAUUAAGCCGGAUCACCUGAAUAAGAAAUGAGUGGCUCCAAACCGUCGAGGAUUACGGUUCUGAAGCCCGU
RS 2 dot .(((…..))).(((((.((((((.((..((((((..(((((.(((((.((…(((………)))..)))))))…..)))……))..)))))))).)))))).)))))….(.((((.((((((((……..)))))).)).)))))..
RS 3 seq GCUAUGCACCAGGGGUGUCUGAAUCUGCUUGCAGCACCGAGCCGCUGCCCCUUUUUUGGGUGGUGGUGGUGGUGGUGAUGUGACUGCGGCAGUUUUAGGCUGAGAAAGUCCCUUAGAACCUGAACAGGAUAAUGCCUGCGUAGGGAGAGUGCUUUUUUUUUUUG
RS 3 dot …….(((…)))(((((((.(((((.(((((((((.((((((((((((…..))).)))))))))..)))))……))))))))).))))))).((((((((.((((….((((..((((……))))..))))))).).))))))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table