Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034690 Similarity: 0.948 Similarity: 0.947 Similarity: 0.947
UTR: 5HSAA034690
Gene: EIF5A
MFE: -43.405
ENS: 0.855
Length: 182.
Predicted Ligands:
cobalamin - 9/20
FMN - 6/20
lysine - 2/20
 RS: URS0000C5442F_595500
MFE: -83.118
Ligand: cobalamin
Species: Burkholderia glumae PG1 Cobalamin riboswitch
 RS: URS000232AE09_1235813
MFE: -41.798
Ligand: cobalamin
Species: Bacteroides pyogenes JCM 10003 Cobalamin riboswitch
 RS: URS0000D95654_1797542
MFE: -66.842
Ligand: FMN
Species: Candidatus Buchananbacteria bacterium RIFCSPHIGHO2_02_FULL_56_16 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034690 URS0000C5442F_595500 URS000232AE09_1235813 URS0000D95654_1797542
Length 182. 182. 181. 182.
Similarity - 0.948 0.947 0.947
Ensemble Norm 0.855 - - -
MFE -43.405 -83.118 -41.798 -66.842
Ligands - cobalamin cobalamin FMN
Gene EIF5A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 23. 9. 14.001
Length SE - 0. 1. 0.
Lev Distance - 56. 64. 63.
UBS 13. 13. 15. 12.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 0.
ILR 1. 4. 3. 2.
H 4. 3. 4. 4.
BL 7. 4. 7. 5.
BR 6. 4. 5. 4.
UN 0.126 0.137 0.144 0.159

Sequences

Field Description
UTR seq + 25 gggagggaagaugagguugaagagauuaaaaaaccgggugcgccugcgcguugcagauuaguugaaaacgcucaggguuugugaggggcggggucacguaugcgcgucauuggacgggucggugggagggaggguggagauggguagggugugugcgATGTGTGGAACTGGGGGGACTGATT
UTR dot + 25 …………..((((………….))))..(((..(((((.(.(((((((((..((((……))))))))))))).).)))))..)))…(.((((.(((((.(((.(((………………………))).))).))))))))).)..(.((….)).)..
RS 1 seq UUGAACGGGAAACAGGAAGCGAUGCGCAUCCAGCGGCGCCUCGCGUGGCCUGUGCUGUCCUCGCAACGGUACGCCGCCGGCGGCGCGCGCAAGCGGGCCGCGCGGAUCGACGAACGCCACUGCCGCGCGCGGCGGGAAGGCCUCGAUCCGUUCGUUUCGAUCGGCGGUCAGCCCGGAUACCG
RS 1 dot …………..(((.(((…))).))).(((((((((((.(((((..(((((((…….))))))))))))))).))))).)))…(((((..(((.((((((((((((((.((((((….))))))…)))……..)))))..)))))).)))….)))))…….
RS 2 seq UAUCUUUGUCUCGGUUUCGGUACUAAAAGAGACUUAGUCAUGAAGGAACGCUGUGCAAGUCGGCGACAGUACCCGCUGCUGUAAUUCUCGGUGAAUCCGUACACGAUGCCACUUCAUUCGAUGAGGGAAGGCGUACGAGGGAGAGAUAAGUCAGAAGACCUGCCGGAACAAACCUACAUAU
RS 2 dot ..((..((.((.((((((……….)))))).)).)).)).(((.((((((((.((.(((((……..))))))))))…..)))))..)))…..(((((((.((((((…))))))…))))).)).((.((……(((….))))).))……………..
RS 3 seq AAGCAUUCUUCGGGGCGGGGUGGAACUCCCCACCGGCGGUAUAGCCCGCGACCCCCUCCCUUUCUGCAUACCCGUUUUUAUACAGAAAGAGAGGGGCUGAACUGGUGCCCGGCUUUCGCUGAAGCUUCAGCGAGGCGAGAAUUCCAGUGCCGACGGUAUAGUCCGGAUGGAAGAAGAUGCGA
RS 3 dot ……….(((((.(((((…))))))).)))((((……))))…((((((.(((((((.(((……..))).))))))).))))))(((.(((.((((((((((((((((((….)))))))))………….))))..)))))))).)))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table