Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA034714 Similarity: 0.985 Similarity: 0.978 Similarity: 0.978
UTR: 5HSAA034714
Gene: EIF6
MFE: -28.557
ENS: 0.914
Length: 96.
Predicted Ligands:
TPP - 10/20
zmp-ztp - 4/20
tetrahydrofolate - 3/20
 RS: URS0000ABD588_908937
MFE: -31.305
Ligand: TPP
Species: Prevotella dentalis DSM 3688 TPP riboswitch (THI element)
 RS: URS0000C1F70A_69370
MFE: -29.365
Ligand: glycine
Species: Microbacterium trichothecenolyticum Glycine riboswitch
 RS: URS0000DB63D4_1542477
MFE: -19.879
Ligand: glutamine
Species: Prochlorococcus phage P-TIM68 Glutamine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA034714 URS0000ABD588_908937 URS0000C1F70A_69370 URS0000DB63D4_1542477
Length 96. 96. 97. 95.
Similarity - 0.985 0.978 0.978
Ensemble Norm 0.914 - - -
MFE -28.557 -31.305 -29.365 -19.879
Ligands - TPP glycine glutamine
Gene EIF6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 14. 1.003
Length SE - 0. 1. 1.
Lev Distance - 19. 23. 28.
UBS 7. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 3.
ILR 1. 1. 2. 1.
H 3. 3. 3. 3.
BL 1. 2. 3. 1.
BR 2. 3. 3. 1.
UN 0.094 0.062 0.093 0.147

Sequences

Field Description
UTR seq + 25 aacggaaaccuuuuuagggaguccaagguacagucgccgcgugcggagcuuguuacugguuacuuggccucATGGCGGTCCGAGCTTCGTTCGAGA
UTR dot + 25 …(((..((((…))))..)))..(((……))).((.((((((((((..(((………(((….)))))).)))))))))).))…
RS 1 seq CGGCUUUCUAAGGGGUGCCAGCCCGUUUGGGCGGCUGAGAUUAUACCCUCGAACCUGAUCCGGAUAAUGCCGGCGUAGGUAAGAUUUCAUCCCUUU
RS 1 dot .(((..(((…))).))).((((….))))((.(((((((.((((..((……..((((……))))))..)))).))))))).))….
RS 2 seq AUCACCCGGGCGGGAGAGCCUCGGCAGCGUGAUCGCCGAGCACCGAAGGAGCAAGCCUCCCCGCCAAUCUCUCAGGUACGCGUACCGUUCGGGCAGG
RS 2 dot …..((((((……))).)))(.(((….))).).((.(((((((.((..((((……………))))..))…)).)))))))…
RS 3 seq AUCGUUCAUCCUUAACAAAGGACGCAAGUAAGCCGACACGGAACGGAUUUCGUUCAUCUCUUAGGAGACGCAAAUGUUGACUGAAGGAACGGGUU
RS 3 dot …((…(((((….))))).))…….(((……..)))..(((((((..((.((((..(((……)))..)))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table