Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035259 Similarity: 0.950 Similarity: 0.948 Similarity: 0.946
UTR: 5HSAA035259
Gene: ELP3
MFE: -50.547
ENS: 0.940
Length: 187.
Predicted Ligands:
cobalamin - 11/20
TPP - 5/20
lysine - 2/20
 RS: URS0000AB4AAB_997346
MFE: -72.549
Ligand: lysine
Species: Desmospora sp. 8437 Lysine riboswitch
 RS: URS0002312F18_1429043
MFE: -50.716
Ligand: cobalamin
Species: Dethiosulfatarculus sandiegensis Cobalamin riboswitch
 RS: URS00019AE408_2653165
MFE: -59.352
Ligand: cobalamin
Species: Pseudomonas sp. 8O Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035259 URS0000AB4AAB_997346 URS0002312F18_1429043 URS00019AE408_2653165
Length 187. 188. 188. 188.
Similarity - 0.950 0.948 0.946
Ensemble Norm 0.940 - - -
MFE -50.547 -72.549 -50.716 -59.352
Ligands - lysine cobalamin cobalamin
Gene ELP3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 7. 24.
Length SE - 1. 1. 1.
Lev Distance - 58. 65. 57.
UBS 14. 14. 12. 17.
BS 0. 0. 0. 0.
ILL 6. 4. 7. 7.
ILR 6. 4. 6. 7.
H 2. 2. 1. 2.
BL 5. 6. 4. 3.
BR 2. 4. 2. 5.
UN 0.096 0.117 0.101 0.096

Sequences

Field Description
UTR seq + 25 agaagcggaaaggugcgaaaggggaaggagaugggggaaaggggugguccgaaaggggcgaacgcccaggcaaucaaaugcugaaccgaacuuuuaccgcgagaauccgcuacccaguccagucgccccgccaccuagggagaucucagcccugcugagcugATGCCCAAGTTAAAGGCGAAACCCA
UTR dot + 25 ………..((.((((…(((..((.(.(((.(((…..(((((..(((((((((….))))…………………..))))))))))…..))).))))))..)))..))))))((((..((.(((….((((((…))))))……))).))…..))))…….
RS 1 seq GUGUGAACUAGAGGAGCGGAUCGUCAUCAGUACCCGUUGGGAGGUUGCGGUAGCCGUGGACCGGCGGGGAAAGGGACAUCCGCCGAAGUUUCCGGCCCGCCGCAGGGCUGGGGAACUGGGCCCGUUCUUGAACAAAGGCGGGACUGUCACGACUCCUGUCCGGGGAGACGUGGAGCACUGUGUAUCAC
RS 1 dot ………..((((((((…(((..((((.((((((……(((((((.((((.(((((((((((……….)))))))..)))).))))..)))))))))).)))..)))))))))))))))……(.((((..((.(((((.(((((…..))))).)))))))..)))).)…..
RS 2 seq GACAACAUAAUUUCGGUGGAUGCCCCAAGGGCUUAAUAGGGAAGUCGGUGAAAAUCCGACGUGGUCCCGCCGCUGUAAUCGGUAGCGAAAACCGCAGCAUAGCCACUGUCUCCCCAAAGGGCGGCGGGAAGGCGCGGCAACUAGGACGAACCGAAAGCCAGAAGACCUGUCCAACGAGAAAUUCCGAU
RS 2 dot ……….(((((.(((((……..(((((….((…(((………(((.(((..((((((((((.(….((.((……..((((……..))))))))….).))))))))))..))))))…….)))…))..)))))………))))).)))))………
RS 3 seq UUUUAACGCAGCAGGGCCGACGCGCAGCAGAUCGUAGACAGGCUCGAAGAGGGAACACGGUAAUACCGUGGCUGCCCCCGCAACUGUAAACAGCGAGUCUGCCGCAACCGCGCCACUGGAUUUCCGGGAAGGCCGCGGCAGAUAAAGACCUGUCAGCCAGGAGACCUGCCGACGAACGCUGGUCGCGA
RS 3 dot ………..((((((((..(((..(((((((((..((((…((..(.(((..((((((…))))))….))))))…))))…..)))).))))))))…)).))).)))……((.((.(((((((((((…….((((…..))))….)))))).))…)))..)).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table