Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA035557 Similarity: 0.975 Similarity: 0.974 Similarity: 0.974
UTR: 5HSAA035557
Gene: ENPP2
MFE: -24.516
ENS: 0.978
Length: 111.
Predicted Ligands:
TPP - 13/20
methionine - 2/20
cobalamin - 2/20
 RS: URS0000C1D6FD_97138
MFE: -23.295
Ligand: TPP
Species: Clostridium sp. ASF356 TPP riboswitch (THI element)
 RS: URS0000D9DA49_1834114
MFE: -42.730
Ligand: methionine
Species: Mycobacterium sp. 852014-51730_SCH5271717 S-adenosyl methionine (SAM) riboswitch,
 RS: URS000232A6D7_1869301
MFE: -31.849
Ligand: cobalamin
Species: Desulfobacterales bacterium C00003106 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA035557 URS0000C1D6FD_97138 URS0000D9DA49_1834114 URS000232A6D7_1869301
Length 111. 110. 112. 112.
Similarity - 0.975 0.974 0.974
Ensemble Norm 0.978 - - -
MFE -24.516 -23.295 -42.730 -31.849
Ligands - TPP methionine cobalamin
Gene ENPP2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 13.001 8.
Length SE - 1. 1. 1.
Lev Distance - 32. 28. 31.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 0. 3.
ILR 4. 3. 2. 3.
H 2. 2. 2. 3.
BL 3. 4. 3. 2.
BR 2. 2. 4. 0.
UN 0.198 0.145 0.161 0.205

Sequences

Field Description
UTR seq + 25 aauagacuaaacccagagccucaaagcagugcacuccgugaaggcaaagagaacacgcugcaaaaggcuuuccaagaauccucgacATGACCCGCCACGCCGATCGGATAA
UTR dot + 25 …………..(((((((….((((((..(((.((….))…)))….))))))…)))))))……(((((((.(.((……)).).)))..))))..
RS 1 seq AAAUGUUGCUAGGGGUGCCAAUGUGGUAUUGGCUGAGAAUAAAACGAAUGUUUUGUACCCUUAAACCUGAACUAGAUAAUGCUAGCGGAGGGAAGCGGUUUAGUGCAAAA
RS 1 dot ………(((((((((.(((((.((.(((……..))).))..)))))..)))))))))….((.(((((((..((((..(….)..))))))))))).))…
RS 2 seq CUUCACGAGACACCGUCGCCAAGCUCCGACUGGGCGGUGCGCCAACCCCACGCUCGUGGGUGGCUCGGAUGACGAAGCGACCGGCAGCAACCGUUGUCGGUAAGAGCGCCCC
RS 2 dot ………….(((((((.((((((.((.(((((((……)))….)))))).)).)))).)).)))))..((((((((((((….)))))))))…..)))…
RS 3 seq UGUGAUCGGGACGAAAGCCGCAAACAGGCCACUGACCGCCUUGGGCGGAUGGAAAGGCGCGGCAAGUAGGACGAACGUAAGCCAGGAGACCCGGACAAGGCCGAACACUCCA
RS 3 dot …………….(((((……(((.((..(((((…)))))..))…))))))))…..((.(……..))).((((…(((……)))….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table